ID: 921291493

View in Genome Browser
Species Human (GRCh38)
Location 1:213662064-213662086
Sequence AGGGAGAACCCAATGTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921291488_921291493 12 Left 921291488 1:213662029-213662051 CCAAATCTCTTACTGGTATAAAT No data
Right 921291493 1:213662064-213662086 AGGGAGAACCCAATGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921291493 Original CRISPR AGGGAGAACCCAATGTTTCT AGG Intergenic
No off target data available for this crispr