ID: 921293901

View in Genome Browser
Species Human (GRCh38)
Location 1:213683984-213684006
Sequence TGAGCTGGCCTCAGTAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921293901_921293903 0 Left 921293901 1:213683984-213684006 CCTGATTTACTGAGGCCAGCTCA No data
Right 921293903 1:213684007-213684029 GTTTCAGCCTTGAAGCATGTAGG No data
921293901_921293904 1 Left 921293901 1:213683984-213684006 CCTGATTTACTGAGGCCAGCTCA No data
Right 921293904 1:213684008-213684030 TTTCAGCCTTGAAGCATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921293901 Original CRISPR TGAGCTGGCCTCAGTAAATC AGG (reversed) Intergenic
No off target data available for this crispr