ID: 921294692

View in Genome Browser
Species Human (GRCh38)
Location 1:213690856-213690878
Sequence CCCTTTTATAGCTCCTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921294692_921294695 12 Left 921294692 1:213690856-213690878 CCACTGAAGGAGCTATAAAAGGG No data
Right 921294695 1:213690891-213690913 GTGAAAGTCCAAGGTACTCCTGG No data
921294692_921294694 3 Left 921294692 1:213690856-213690878 CCACTGAAGGAGCTATAAAAGGG No data
Right 921294694 1:213690882-213690904 TCTGCTTTTGTGAAAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921294692 Original CRISPR CCCTTTTATAGCTCCTTCAG TGG (reversed) Intergenic
No off target data available for this crispr