ID: 921294975

View in Genome Browser
Species Human (GRCh38)
Location 1:213693010-213693032
Sequence CTGCCCTAAAGGGCTTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921294965_921294975 26 Left 921294965 1:213692961-213692983 CCTACTGTAATACTAGTTCCTGG No data
Right 921294975 1:213693010-213693032 CTGCCCTAAAGGGCTTAATGAGG No data
921294969_921294975 8 Left 921294969 1:213692979-213693001 CCTGGGCCAGTCCTGGAACACAC No data
Right 921294975 1:213693010-213693032 CTGCCCTAAAGGGCTTAATGAGG No data
921294971_921294975 -3 Left 921294971 1:213692990-213693012 CCTGGAACACACCAGAGTCTCTG No data
Right 921294975 1:213693010-213693032 CTGCCCTAAAGGGCTTAATGAGG No data
921294970_921294975 2 Left 921294970 1:213692985-213693007 CCAGTCCTGGAACACACCAGAGT No data
Right 921294975 1:213693010-213693032 CTGCCCTAAAGGGCTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921294975 Original CRISPR CTGCCCTAAAGGGCTTAATG AGG Intergenic
No off target data available for this crispr