ID: 921295054

View in Genome Browser
Species Human (GRCh38)
Location 1:213693604-213693626
Sequence CCTTCCTCAGGCAGGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921295054_921295064 3 Left 921295054 1:213693604-213693626 CCACCCTGCCTGCCTGAGGAAGG No data
Right 921295064 1:213693630-213693652 CCATTAGTGTCTGGCAGCCCAGG No data
921295054_921295061 -6 Left 921295054 1:213693604-213693626 CCACCCTGCCTGCCTGAGGAAGG No data
Right 921295061 1:213693621-213693643 GGAAGGGACCCATTAGTGTCTGG No data
921295054_921295065 16 Left 921295054 1:213693604-213693626 CCACCCTGCCTGCCTGAGGAAGG No data
Right 921295065 1:213693643-213693665 GCAGCCCAGGTCCTGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921295054 Original CRISPR CCTTCCTCAGGCAGGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr