ID: 921296044

View in Genome Browser
Species Human (GRCh38)
Location 1:213704989-213705011
Sequence CTGAACAATCTGAAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921296041_921296044 4 Left 921296041 1:213704962-213704984 CCTGAACAAATGGAGTCTCTCTC No data
Right 921296044 1:213704989-213705011 CTGAACAATCTGAAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921296044 Original CRISPR CTGAACAATCTGAAGCTGGA GGG Intergenic
No off target data available for this crispr