ID: 921296913

View in Genome Browser
Species Human (GRCh38)
Location 1:213712709-213712731
Sequence CAGTGAGGGACGGTGGTATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921296913_921296925 9 Left 921296913 1:213712709-213712731 CCGGATACCACCGTCCCTCACTG No data
Right 921296925 1:213712741-213712763 TCACAGCTTCCCTGGGCTTGGGG No data
921296913_921296926 12 Left 921296913 1:213712709-213712731 CCGGATACCACCGTCCCTCACTG No data
Right 921296926 1:213712744-213712766 CAGCTTCCCTGGGCTTGGGGAGG No data
921296913_921296919 1 Left 921296913 1:213712709-213712731 CCGGATACCACCGTCCCTCACTG No data
Right 921296919 1:213712733-213712755 AGGATCCCTCACAGCTTCCCTGG No data
921296913_921296924 8 Left 921296913 1:213712709-213712731 CCGGATACCACCGTCCCTCACTG No data
Right 921296924 1:213712740-213712762 CTCACAGCTTCCCTGGGCTTGGG No data
921296913_921296923 7 Left 921296913 1:213712709-213712731 CCGGATACCACCGTCCCTCACTG No data
Right 921296923 1:213712739-213712761 CCTCACAGCTTCCCTGGGCTTGG No data
921296913_921296927 13 Left 921296913 1:213712709-213712731 CCGGATACCACCGTCCCTCACTG No data
Right 921296927 1:213712745-213712767 AGCTTCCCTGGGCTTGGGGAGGG No data
921296913_921296920 2 Left 921296913 1:213712709-213712731 CCGGATACCACCGTCCCTCACTG No data
Right 921296920 1:213712734-213712756 GGATCCCTCACAGCTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921296913 Original CRISPR CAGTGAGGGACGGTGGTATC CGG (reversed) Intergenic
No off target data available for this crispr