ID: 921298529

View in Genome Browser
Species Human (GRCh38)
Location 1:213727327-213727349
Sequence CCTTCTGAGATGAGGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921298524_921298529 4 Left 921298524 1:213727300-213727322 CCTCTGTGCAAATACTAAGAAAG No data
Right 921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG No data
921298523_921298529 27 Left 921298523 1:213727277-213727299 CCGAAACTCACAGGTCATCATAT No data
Right 921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921298529 Original CRISPR CCTTCTGAGATGAGGGTACA GGG Intergenic
No off target data available for this crispr