ID: 921298529 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:213727327-213727349 |
Sequence | CCTTCTGAGATGAGGGTACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
921298524_921298529 | 4 | Left | 921298524 | 1:213727300-213727322 | CCTCTGTGCAAATACTAAGAAAG | No data | ||
Right | 921298529 | 1:213727327-213727349 | CCTTCTGAGATGAGGGTACAGGG | No data | ||||
921298523_921298529 | 27 | Left | 921298523 | 1:213727277-213727299 | CCGAAACTCACAGGTCATCATAT | No data | ||
Right | 921298529 | 1:213727327-213727349 | CCTTCTGAGATGAGGGTACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
921298529 | Original CRISPR | CCTTCTGAGATGAGGGTACA GGG | Intergenic | ||
No off target data available for this crispr |