ID: 921300591

View in Genome Browser
Species Human (GRCh38)
Location 1:213748022-213748044
Sequence CTGTGTATGAGGAGCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921300587_921300591 27 Left 921300587 1:213747972-213747994 CCTAGGTGATGAAATGCTAATTA No data
Right 921300591 1:213748022-213748044 CTGTGTATGAGGAGCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921300591 Original CRISPR CTGTGTATGAGGAGCCAGGT GGG Intergenic
No off target data available for this crispr