ID: 921300681

View in Genome Browser
Species Human (GRCh38)
Location 1:213748952-213748974
Sequence TTTCATAGCCAACACTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921300681_921300684 -7 Left 921300681 1:213748952-213748974 CCTCCGCAGTGTTGGCTATGAAA No data
Right 921300684 1:213748968-213748990 TATGAAAATGTTCACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921300681 Original CRISPR TTTCATAGCCAACACTGCGG AGG (reversed) Intergenic
No off target data available for this crispr