ID: 921301759

View in Genome Browser
Species Human (GRCh38)
Location 1:213757802-213757824
Sequence TTGTTTCAGGCTAATGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921301753_921301759 18 Left 921301753 1:213757761-213757783 CCATACCTGGCTTCAAAGCTTCA 0: 3
1: 6
2: 21
3: 39
4: 248
Right 921301759 1:213757802-213757824 TTGTTTCAGGCTAATGCATCTGG No data
921301755_921301759 13 Left 921301755 1:213757766-213757788 CCTGGCTTCAAAGCTTCAAAGGA 0: 227
1: 486
2: 584
3: 402
4: 394
Right 921301759 1:213757802-213757824 TTGTTTCAGGCTAATGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921301759 Original CRISPR TTGTTTCAGGCTAATGCATC TGG Intergenic
No off target data available for this crispr