ID: 921301759 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:213757802-213757824 |
| Sequence | TTGTTTCAGGCTAATGCATC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921301753_921301759 | 18 | Left | 921301753 | 1:213757761-213757783 | CCATACCTGGCTTCAAAGCTTCA | 0: 3 1: 6 2: 21 3: 39 4: 248 |
||
| Right | 921301759 | 1:213757802-213757824 | TTGTTTCAGGCTAATGCATCTGG | No data | ||||
| 921301755_921301759 | 13 | Left | 921301755 | 1:213757766-213757788 | CCTGGCTTCAAAGCTTCAAAGGA | 0: 227 1: 486 2: 584 3: 402 4: 394 |
||
| Right | 921301759 | 1:213757802-213757824 | TTGTTTCAGGCTAATGCATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921301759 | Original CRISPR | TTGTTTCAGGCTAATGCATC TGG | Intergenic | ||
| No off target data available for this crispr | |||||