ID: 921307407

View in Genome Browser
Species Human (GRCh38)
Location 1:213810817-213810839
Sequence TCTTATCTGTAAAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921307407_921307409 23 Left 921307407 1:213810817-213810839 CCATCCTCATTTTACAGATAAGA No data
Right 921307409 1:213810863-213810885 CTCTCATCCCAGCAAAAAGCTGG No data
921307407_921307411 30 Left 921307407 1:213810817-213810839 CCATCCTCATTTTACAGATAAGA No data
Right 921307411 1:213810870-213810892 CCCAGCAAAAAGCTGGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921307407 Original CRISPR TCTTATCTGTAAAATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr