ID: 921310287

View in Genome Browser
Species Human (GRCh38)
Location 1:213835565-213835587
Sequence GCCTCTCCTGCATTTCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921310287_921310289 -9 Left 921310287 1:213835565-213835587 CCCTCAAGAAATGCAGGAGAGGC No data
Right 921310289 1:213835579-213835601 AGGAGAGGCTTTCTGCACAGAGG No data
921310287_921310290 6 Left 921310287 1:213835565-213835587 CCCTCAAGAAATGCAGGAGAGGC No data
Right 921310290 1:213835594-213835616 CACAGAGGAATAGCATGAACAGG No data
921310287_921310291 15 Left 921310287 1:213835565-213835587 CCCTCAAGAAATGCAGGAGAGGC No data
Right 921310291 1:213835603-213835625 ATAGCATGAACAGGATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921310287 Original CRISPR GCCTCTCCTGCATTTCTTGA GGG (reversed) Intergenic