ID: 921317964

View in Genome Browser
Species Human (GRCh38)
Location 1:213909765-213909787
Sequence CATGCTTTGAAGCAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921317960_921317964 14 Left 921317960 1:213909728-213909750 CCAAAAGATAGTTTGAATGCAAA No data
Right 921317964 1:213909765-213909787 CATGCTTTGAAGCAGGGACAGGG No data
921317957_921317964 21 Left 921317957 1:213909721-213909743 CCTGGCCCCAAAAGATAGTTTGA No data
Right 921317964 1:213909765-213909787 CATGCTTTGAAGCAGGGACAGGG No data
921317959_921317964 15 Left 921317959 1:213909727-213909749 CCCAAAAGATAGTTTGAATGCAA No data
Right 921317964 1:213909765-213909787 CATGCTTTGAAGCAGGGACAGGG No data
921317958_921317964 16 Left 921317958 1:213909726-213909748 CCCCAAAAGATAGTTTGAATGCA No data
Right 921317964 1:213909765-213909787 CATGCTTTGAAGCAGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921317964 Original CRISPR CATGCTTTGAAGCAGGGACA GGG Intergenic
No off target data available for this crispr