ID: 921320392

View in Genome Browser
Species Human (GRCh38)
Location 1:213932855-213932877
Sequence AAAGATCCAAAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921320392_921320397 11 Left 921320392 1:213932855-213932877 CCATCCTCCTTCTTTGGATCTTT No data
Right 921320397 1:213932889-213932911 ATAGTACTGCCTTTTCCATAGGG No data
921320392_921320396 10 Left 921320392 1:213932855-213932877 CCATCCTCCTTCTTTGGATCTTT No data
Right 921320396 1:213932888-213932910 TATAGTACTGCCTTTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921320392 Original CRISPR AAAGATCCAAAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr