ID: 921320392 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:213932855-213932877 |
| Sequence | AAAGATCCAAAGAAGGAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921320392_921320397 | 11 | Left | 921320392 | 1:213932855-213932877 | CCATCCTCCTTCTTTGGATCTTT | No data | ||
| Right | 921320397 | 1:213932889-213932911 | ATAGTACTGCCTTTTCCATAGGG | No data | ||||
| 921320392_921320396 | 10 | Left | 921320392 | 1:213932855-213932877 | CCATCCTCCTTCTTTGGATCTTT | No data | ||
| Right | 921320396 | 1:213932888-213932910 | TATAGTACTGCCTTTTCCATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921320392 | Original CRISPR | AAAGATCCAAAGAAGGAGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||