ID: 921326633

View in Genome Browser
Species Human (GRCh38)
Location 1:213990548-213990570
Sequence CACTTTAGGCAGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921326621_921326633 13 Left 921326621 1:213990512-213990534 CCAGGCTTCTGTCTGCCAGTCAG 0: 1
1: 0
2: 1
3: 18
4: 280
Right 921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG 0: 1
1: 0
2: 5
3: 28
4: 259
921326620_921326633 14 Left 921326620 1:213990511-213990533 CCCAGGCTTCTGTCTGCCAGTCA 0: 1
1: 0
2: 0
3: 20
4: 228
Right 921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG 0: 1
1: 0
2: 5
3: 28
4: 259
921326622_921326633 -2 Left 921326622 1:213990527-213990549 CCAGTCAGCCCAAAGCACCCCCA 0: 1
1: 0
2: 1
3: 20
4: 175
Right 921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG 0: 1
1: 0
2: 5
3: 28
4: 259
921326624_921326633 -10 Left 921326624 1:213990535-213990557 CCCAAAGCACCCCCACTTTAGGC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG 0: 1
1: 0
2: 5
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921326633 Original CRISPR CACTTTAGGCAGCAGGTGGA GGG Intronic
900402790 1:2479450-2479472 CACTGGGGGCTGCAGGTGGAGGG + Intronic
901001710 1:6152078-6152100 CCATTTGGGCAGGAGGTGGAGGG - Intronic
902143738 1:14379186-14379208 CTCTTTAGTCAGCAGGTGATGGG - Intergenic
903375689 1:22864401-22864423 CATTTTAGGCAGCAGAAGCAGGG + Intronic
903456507 1:23490964-23490986 GACATTAGGCAGCTGCTGGAGGG - Intergenic
903810835 1:26034249-26034271 CACTTCAGGCAGCTTCTGGAAGG - Intronic
905011784 1:34752038-34752060 CATTTTAGGAAGCAGGCAGAGGG + Intronic
905472521 1:38204289-38204311 CAGTTAAGGCAGGAGATGGAGGG + Intergenic
906692671 1:47802876-47802898 CCCTTTAGCCTGCAGGTGGGAGG - Intronic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
910871162 1:91834525-91834547 CACTTTAGGTAGTAGGTGTTCGG - Intronic
912242626 1:107927242-107927264 CACTTTAGTCAGAAGGTGATTGG - Intronic
915459086 1:156059113-156059135 CACTTTGGGAGGCAGGAGGATGG - Intergenic
916353083 1:163874358-163874380 CACTTTGGGCAGGAGGAGGGAGG + Intergenic
917904961 1:179579549-179579571 CACTTTATGGACAAGGTGGAAGG + Intergenic
918980787 1:191555895-191555917 CACCTTTGCCAGCAGGGGGAGGG + Intergenic
921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG + Intronic
922062703 1:222107281-222107303 CACTTTGGGTATCAGGTTGATGG + Intergenic
922569994 1:226628944-226628966 CACTAGAGGCAGCAGGCGAAGGG + Intergenic
922663772 1:227451906-227451928 CTCTGCAGTCAGCAGGTGGAGGG + Intergenic
924427906 1:243970719-243970741 CACTTTGGGAGGCAGGTGGGTGG - Intergenic
1064858929 10:19803859-19803881 CACTTTGGGAGGCAGGTGGGAGG - Intergenic
1065467787 10:26044012-26044034 CTCTTTAGTCAGCAGGTGATGGG + Intronic
1069096580 10:64266778-64266800 CACATTAGGAAGCAGGGAGAAGG - Intergenic
1069299051 10:66884009-66884031 CACTTATGGCAGAAGGTGAAGGG + Intronic
1070401414 10:76056461-76056483 CACTATAGACAGCAGGTTGATGG - Intronic
1070840986 10:79487771-79487793 CACTTCAGACACCAGGGGGAAGG - Intergenic
1072875371 10:99167252-99167274 CACTTTGGGAGGCAGGTGGGTGG - Intronic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1075194960 10:120348372-120348394 CTCTTTAGTCAGCAGGTGATGGG - Intergenic
1075824112 10:125339100-125339122 CACTTAAGGAAGAAGGTGAAAGG - Intergenic
1079517009 11:21281258-21281280 CTCTTTAGTCAGCAGGTGAAGGG - Intronic
1081836588 11:46160414-46160436 CACTGCTGCCAGCAGGTGGAGGG - Intergenic
1081911929 11:46705295-46705317 CAGTTCAGGCAGCTGGGGGAAGG - Exonic
1082830674 11:57614669-57614691 CACCTGAGGCAGGAGGTGGCAGG - Exonic
1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG + Intergenic
1084362773 11:68679759-68679781 CACTCCAGGCAGCAGGAAGAAGG + Intergenic
1084952876 11:72676393-72676415 CACTCAAGCAAGCAGGTGGAAGG + Intergenic
1085381861 11:76127246-76127268 CACATTAAGCATCAGTTGGATGG + Intronic
1085704003 11:78769769-78769791 GGATTTAGGCAGCAGGTGGAAGG + Intronic
1085896750 11:80648923-80648945 CATTTAAGGCATCAGATGGAAGG + Intergenic
1086459275 11:86989651-86989673 CACTTTAGGGAGCATGGGCATGG - Intergenic
1087369624 11:97266443-97266465 CACTTATGGCAGAAGGTGAAAGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1091302039 11:134514069-134514091 CACTCTATGGAGCAGGTGGGAGG + Intergenic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1094436046 12:30422100-30422122 CACTTTAGGCAGCATATTTAAGG - Intergenic
1094568935 12:31625077-31625099 CACTTTGGGAGGCAGGAGGATGG + Intergenic
1095574490 12:43720088-43720110 CACTTAAAGCAGCATGTAGAGGG - Intergenic
1095625016 12:44304334-44304356 CACTTTAGCCTGCAGTTGGGAGG - Intronic
1095632961 12:44399440-44399462 CACTCTAGGCAGCAGGGTCATGG + Intergenic
1096536089 12:52275737-52275759 CACTGGTGACAGCAGGTGGATGG + Intronic
1098194284 12:67983483-67983505 CACTTATGGCAGAAGGTGAAGGG - Intergenic
1099218693 12:79885493-79885515 CACTTTTGGTGGCAGGTGGCAGG + Intronic
1099397827 12:82163043-82163065 TCCTTTAAGAAGCAGGTGGAGGG - Intergenic
1101580917 12:106040266-106040288 TACTTTAGACAGCATGTTGATGG - Intergenic
1102398600 12:112609488-112609510 AACAATAGGCAGGAGGTGGAAGG - Intronic
1103560065 12:121788962-121788984 CATTTTAGGTAGAATGTGGAGGG - Intronic
1103786341 12:123436116-123436138 CACCTCAGGAAGGAGGTGGAGGG - Exonic
1104066988 12:125314356-125314378 AACTCTAGGCAGCAGATGGGAGG + Intronic
1107050605 13:36044173-36044195 CACTCTTGGCAGAAGGTGAAGGG - Intronic
1107613387 13:42139579-42139601 TACTAGAGGCAGCAGGTTGAAGG - Intronic
1107782950 13:43924613-43924635 CACTTAAGGCAGAAAGTGAAGGG + Intergenic
1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG + Intergenic
1110323116 13:74182604-74182626 CACTGTGTGCAGCAGTTGGAGGG - Intergenic
1111847764 13:93533355-93533377 CACCTAAGGAAACAGGTGGAGGG - Intronic
1113229258 13:108194813-108194835 GAGCTGAGGCAGCAGGTGGATGG - Intergenic
1113397625 13:109963404-109963426 CACATTGGGAAGCAGGCGGAGGG + Intergenic
1116021651 14:39469015-39469037 CTCTTTAGTCAGCAGGTGATGGG + Intergenic
1116448568 14:45039451-45039473 CACTATGGACAGCAGGTTGATGG - Intronic
1121253181 14:92514227-92514249 CACTTTAGGCTGCTGGTGGACGG + Intronic
1122887984 14:104719032-104719054 GCCTTTAGGAAGCAGGTGGGAGG - Exonic
1123663968 15:22592038-22592060 CACTTTAGTTAGCAGAAGGAAGG + Intergenic
1124317798 15:28686479-28686501 CACTTTAGTTAGCAGAAGGAAGG + Intergenic
1124870931 15:33541785-33541807 CTCTTTTGGCAACAAGTGGAAGG + Intronic
1125153157 15:36556539-36556561 CACTTTAGGAGGCAGGTGGATGG + Intergenic
1125441625 15:39709642-39709664 CCCTTTAGGCAATAGGGGGAGGG + Intronic
1126096418 15:45094034-45094056 CACCTTAGGCCTCAGCTGGAGGG - Exonic
1128921067 15:71610721-71610743 CACTTTATACAGCATGGGGAAGG - Intronic
1128943092 15:71804459-71804481 CACCTGGTGCAGCAGGTGGACGG + Intronic
1129037955 15:72662320-72662342 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129211934 15:74074911-74074933 CACCTGAGGCAGGAGGTGGAAGG - Exonic
1129271310 15:74420727-74420749 CAGTTTGGGCTGCGGGTGGAAGG - Intronic
1129398469 15:75266173-75266195 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129402077 15:75290449-75290471 CACCTGAGGCAGGAGGTGGAAGG + Exonic
1129729060 15:77919225-77919247 CACCTGAGGCAGGAGGTGGAAGG - Intergenic
1130742411 15:86615106-86615128 CACATTAAGCAGCATGTTGAGGG + Intronic
1131528747 15:93174093-93174115 CACTCAAGGCAGAAGGTGAAGGG + Intergenic
1133760894 16:8797618-8797640 TACTTCCGGCAGCAGGTGGTGGG - Exonic
1134626730 16:15727727-15727749 CACTTTGGGAAGCAGGCAGAAGG + Intronic
1135012626 16:18895526-18895548 CACTCTAGGGGGCAGGGGGAAGG + Intronic
1135518658 16:23156510-23156532 CACTTATGGCAGAAGGTGAAAGG - Intergenic
1137744775 16:50812580-50812602 CACCTGAGGCAGGAGGTGGCAGG - Intergenic
1142135602 16:88450628-88450650 CACAATGGGCAGCAGGTGGGGGG + Intergenic
1142615167 17:1130059-1130081 AACGTTAGACAGCAGGTGAATGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1144772045 17:17765325-17765347 CAGTCCAGGCAGGAGGTGGAGGG + Intronic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1146820145 17:35978218-35978240 TACTTCAGGCAGCAGGTGGATGG + Exonic
1147381331 17:40057976-40057998 CACTATGGGCAGCAGGTGGATGG + Intronic
1148017748 17:44534251-44534273 CACTTTGGGAGGCAGGAGGATGG + Intergenic
1148132558 17:45270797-45270819 CCCGTTAGGAGGCAGGTGGATGG + Intronic
1148904558 17:50903923-50903945 CACTTTAGGAAACAGTTGGGTGG + Intergenic
1150169142 17:62973533-62973555 AACTTTAGGCACCAGGAGGTAGG + Intergenic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1152426827 17:80222591-80222613 CACACTAGGGAGCTGGTGGATGG + Intronic
1153040537 18:809544-809566 CACTTTAGGAGGCAGAGGGAAGG - Intronic
1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG + Intronic
1153924098 18:9817909-9817931 CACTAGAGGTAGCAGCTGGATGG - Intronic
1154558007 18:15783482-15783504 CACTTTCTGTAGCATGTGGAAGG + Intergenic
1154913823 18:20695179-20695201 CACTTTCTGTAGCATGTGGAAGG + Intergenic
1155355110 18:24944271-24944293 GGCTTTAGGCAGAAGGAGGAGGG + Intergenic
1155523454 18:26692212-26692234 CATTTTAGGCAGCACGATGAAGG - Intergenic
1155583209 18:27335734-27335756 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1156912468 18:42426672-42426694 CACTTTAGCCTGCAGTTGCAAGG + Intergenic
1158889690 18:61861716-61861738 CACTTATGGCAGCAGGTGAAGGG + Intronic
1159627364 18:70710177-70710199 CATTTTAGGCACCAGATGTAAGG - Intergenic
1161794007 19:6376150-6376172 CACTCCAGGCAGCAGGTCGGGGG - Intronic
1164883266 19:31754525-31754547 TACTCAAGGCAGAAGGTGGAGGG + Intergenic
1165007518 19:32818741-32818763 CGTTGTAGCCAGCAGGTGGAGGG + Intronic
1165973712 19:39656232-39656254 GACTTTAGGTGGGAGGTGGATGG + Intronic
1167656790 19:50770119-50770141 CACTTTGGGAGGCTGGTGGACGG + Intergenic
926412219 2:12616284-12616306 CAATTTTGGCAGCTGGAGGAAGG + Intergenic
926459419 2:13110355-13110377 TACTTCATGCAGCAGGTGGGTGG - Intergenic
926834176 2:16999231-16999253 CTCTTTAGTCAGCAGGTGATAGG + Intergenic
927525173 2:23733406-23733428 AAGTTTAAGCAGCAGGTAGAGGG - Intergenic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928846243 2:35676684-35676706 CACTTTAGCCTGCAGTGGGAGGG + Intergenic
929123762 2:38504364-38504386 CACATGAGGCAGCAGGTGGCTGG + Intergenic
929821160 2:45274817-45274839 CAGCTCAGACAGCAGGTGGAAGG + Intergenic
930137663 2:47918572-47918594 CACTTTAGGAGACAGGTGGGAGG + Intergenic
930558254 2:52927636-52927658 TAATTTAGGCAACAGGTGGCGGG - Intergenic
930611916 2:53553855-53553877 CACTTGAGCCTGCAGGGGGAAGG - Intronic
930727378 2:54695172-54695194 CTCTTTAGTCAGCAGGTGACGGG - Intergenic
931171445 2:59807700-59807722 CACTTCAGGGAGCACGTGCAGGG - Intergenic
931632107 2:64310939-64310961 CACTATAGTCAGCAGCTGAAGGG + Intergenic
931965890 2:67534218-67534240 TGCTTAAGCCAGCAGGTGGAAGG - Intergenic
932022773 2:68104613-68104635 CACTTATGGCAGAAGGTGAAAGG + Intronic
932184344 2:69679578-69679600 CACTTTAGGACACAGGTGTAGGG - Intronic
935938953 2:108218414-108218436 CACTTCTGGCAGAAGGTGAAGGG - Intergenic
937908897 2:127065871-127065893 CTCTTTAGGAAGCATGTGGAAGG + Intronic
938982810 2:136542635-136542657 CGTTCTAGACAGCAGGTGGAAGG + Intergenic
939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG + Intergenic
942992590 2:182219034-182219056 TACTTTGGGTAGCAGGTGAAGGG + Intronic
946143337 2:217710386-217710408 CACCTTAGGCAGCAGGAAGCTGG - Intronic
946791082 2:223301022-223301044 CCCATTATCCAGCAGGTGGATGG + Intergenic
948995184 2:241574492-241574514 CACTTTGGGAGGCAGGAGGATGG + Intergenic
1169597201 20:7214041-7214063 CACTTTAGCCTGCAGGGGGTGGG - Intergenic
1169602348 20:7276037-7276059 AACTTGAGGCAGCTGGTGTAAGG + Intergenic
1170185396 20:13583834-13583856 CACTTTAGGAGGCTGGTGGGTGG + Intronic
1170652811 20:18258012-18258034 CACTTGAGTCAACAGGTTGAAGG - Intergenic
1171055224 20:21900207-21900229 CACTTGAGCCAGAAGGTTGAAGG - Intergenic
1172858987 20:38032902-38032924 AACTTTAGGGAAAAGGTGGAGGG - Intronic
1174000174 20:47368954-47368976 GACTTGAGGGACCAGGTGGATGG - Intergenic
1174032400 20:47640462-47640484 CTCAATAGGCAGCAGGTGGTTGG - Intronic
1174048269 20:47749050-47749072 CACTCTAGGCAGCAAGAAGAAGG - Intronic
1176378595 21:6100414-6100436 CACTTCAGGCAGCCACTGGAAGG - Intergenic
1178660391 21:34502950-34502972 CACTTTTGGCACCAGATAGATGG + Intergenic
1179744880 21:43437823-43437845 CACTTCAGGCAGCCACTGGAAGG + Intergenic
1180606737 22:17064689-17064711 CACTTTAGGCAGGCGGTGACAGG + Intergenic
1180677355 22:17596482-17596504 CACTCATGGCAGAAGGTGGAAGG - Intronic
1181576791 22:23800450-23800472 GACTTTACTCAGCAGGTGGCTGG - Intronic
1182886777 22:33780455-33780477 CACTCCAGGCAGCTGGAGGATGG + Intronic
1183898865 22:40990471-40990493 CACTTTAGGAAGCCGAAGGAGGG + Intergenic
1184970719 22:48018032-48018054 CACATCAGGCTGCAGGTTGACGG - Intergenic
950101080 3:10357398-10357420 CATTTTAGGCAGCAGGGAGAGGG - Intronic
951346941 3:21558306-21558328 CACTTAAAGCAGCATGTGGAGGG - Intronic
951693480 3:25421248-25421270 CATTTCAGGCTGCAGGTGGAGGG - Intronic
952945580 3:38476311-38476333 CACTTCCTGCAGCAGGTGGAAGG + Intronic
954075501 3:48175919-48175941 CACTTTGGGAGGCAGGTGGATGG + Intronic
954534681 3:51350686-51350708 CACTGGAGGCAGAAGTTGGAAGG - Intronic
954800629 3:53185113-53185135 GAATTTAGGCAGCAGAGGGAGGG + Intronic
955263942 3:57423535-57423557 TACTTTGGGCAGCAAATGGAAGG + Intronic
955451368 3:59070850-59070872 AGGATTAGGCAGCAGGTGGAAGG - Intergenic
957253941 3:77812370-77812392 CACTTTAGGCTGCATTTGGCTGG - Intergenic
961379164 3:126486192-126486214 GCCTCTAGGCAGCAGGTGGGTGG - Intronic
961459700 3:127042639-127042661 CACTCCAGGCAGCCAGTGGAGGG - Intergenic
962702124 3:138010166-138010188 CACCTTCGGCAGCAGGAGGGCGG + Exonic
962859213 3:139382336-139382358 AAATTTTGGCAGCAGGTGAAGGG - Intronic
962887785 3:139643434-139643456 CACAGTAGCCAGAAGGTGGAAGG + Intronic
964524447 3:157603394-157603416 GCCTTGAGGCAGCAGGTTGATGG - Intronic
968226684 3:196976823-196976845 CACTGTAGGAAGCTGGAGGATGG + Intergenic
970528203 4:16954560-16954582 CACTTGTGGCAGAAGGTGAAAGG + Intergenic
972129448 4:35812525-35812547 CTCATTAGGAAGCAGGTGGGGGG - Intergenic
976922763 4:90458232-90458254 CACTCCATGGAGCAGGTGGAAGG - Intronic
976931134 4:90568567-90568589 CTCTTTAGGCAGCATATAGATGG + Intronic
987061544 5:14248519-14248541 CACCTACGGCAGCAGGTGCAGGG - Intronic
988498791 5:31766969-31766991 CACTTTGGGAGGCAGGTGGGTGG - Intronic
989751218 5:44895915-44895937 CACTTTAGTCAGCTGGTGATGGG + Intergenic
991354624 5:65754922-65754944 CACTGGAGTCAGCAGGTTGATGG - Intronic
992401318 5:76414323-76414345 CAGTTTAGGGGGCAGGTGAATGG - Intronic
993611299 5:90057704-90057726 TACTTTAGGGAGTGGGTGGAAGG - Intergenic
994406583 5:99352757-99352779 CACTGTGGACAGCAGGTTGATGG - Intergenic
995491179 5:112693032-112693054 CACTATTGGCAGCAGGGTGATGG - Intergenic
995726307 5:115184422-115184444 CACTTATGGCAGAAGGTGAAGGG + Intergenic
995862979 5:116661227-116661249 CACTGTAGACAGCAGGTTAATGG + Intergenic
997564367 5:134875603-134875625 CACTTTGGGAAACAGGTGGGAGG - Intronic
998131307 5:139652448-139652470 GGCTTTAGGGGGCAGGTGGAGGG - Intronic
998763347 5:145456535-145456557 CATTTTGGGTAGCAGGTTGAGGG - Intergenic
999226907 5:150033236-150033258 CACTTGAGGCAGCAAATGGAAGG + Intronic
999713685 5:154341821-154341843 CCCTTTAGGCTGCAGGGGGATGG + Intronic
1000633596 5:163618167-163618189 CAATAAGGGCAGCAGGTGGAGGG + Intergenic
1001415076 5:171540004-171540026 CACTTTGGGAAGCAGGGGGGTGG - Intergenic
1002700235 5:181118943-181118965 CACTTTAGGCAAAAGGTGGAAGG + Intergenic
1004750497 6:18557423-18557445 CACTTGAACCAGGAGGTGGAAGG + Intergenic
1005276811 6:24228341-24228363 GATTTTAAGCAGCAGGTGGTAGG + Intronic
1006076841 6:31538853-31538875 CACCTTAGGCAGGAAGTAGACGG + Exonic
1006349948 6:33513625-33513647 CTCAGAAGGCAGCAGGTGGAGGG - Intergenic
1006666271 6:35696274-35696296 CACTTTGGGAGGCAGGTGGAAGG + Intronic
1011322846 6:86116127-86116149 CTCTTTAGTCAGCAGGTGATGGG + Intergenic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1012964608 6:105660173-105660195 CAATTATGGCAGCAGGTGAAGGG + Intergenic
1014288538 6:119531166-119531188 CAATTTTGGCAGAAGGTGAAGGG - Intergenic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018433043 6:163737848-163737870 AACTGTGGGCAGCAGGTGGGGGG + Intergenic
1018731005 6:166650429-166650451 CACTTTAGGCTGGAGGTGGGAGG + Intronic
1018807754 6:167274376-167274398 CCCTTTAGGCAGGAGGAGGGAGG - Intronic
1019048288 6:169164329-169164351 CACTTTGGGAGGCAGGTGGATGG - Intergenic
1021343159 7:19489215-19489237 CACTGTGGACAGCAGGTTGATGG - Intergenic
1021484476 7:21152345-21152367 TAGTTTAGGCATTAGGTGGAAGG + Intergenic
1022160655 7:27707773-27707795 CACTTTGGGAGGCAGGTGGACGG + Intergenic
1023870065 7:44258579-44258601 CACTGGAGGCAGCGGGTGGGTGG - Intronic
1024377637 7:48657251-48657273 CACTTTTGGCAGCAAGTAAACGG + Intergenic
1030636414 7:111954309-111954331 TACTTTGGGAAGCAGCTGGAAGG + Intronic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1031461383 7:122053418-122053440 CACTTTAAGGAACTGGTGGATGG + Intronic
1033482519 7:141756089-141756111 CACGTTGGGCACCAGGTGAAGGG + Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1034783154 7:153900474-153900496 CACTCATGGCAGAAGGTGGAGGG + Intronic
1035235369 7:157494474-157494496 CACTCTTGGCAGAAGGTGAAGGG + Intergenic
1035261514 7:157664519-157664541 CACTTTGGGAAGTAGGTGGGAGG + Intronic
1035765973 8:2105712-2105734 CACTTTAGGGAGGACCTGGAGGG - Intronic
1036292527 8:7506362-7506384 CACTTTGGGCACCAGATGTAGGG + Intronic
1036987887 8:13557148-13557170 CACTTGAGGAAGAAGGTGAAAGG - Intergenic
1038413059 8:27373314-27373336 CACTTTAGACAGCAGCTTGTTGG - Intronic
1038572571 8:28675617-28675639 CACTTCACCCAGTAGGTGGAAGG + Intronic
1038989558 8:32853135-32853157 CACTTTAGTCAGAAGGTGAGGGG + Intergenic
1039161289 8:34624717-34624739 CAATTATGGCAGCAGGTGAAGGG + Intergenic
1039534456 8:38295476-38295498 GGCTTCAGCCAGCAGGTGGAGGG + Intronic
1041899789 8:62969017-62969039 CACTTTATGTGGTAGGTGGAAGG - Intronic
1044233038 8:89800960-89800982 CATTTTAGGAAGCAGATAGAAGG - Intergenic
1044251201 8:90005831-90005853 CACTTGTGGCAGAAGGTGAAGGG + Intronic
1044636689 8:94332287-94332309 CACTTATGGCAGAAGGTGAAAGG + Intergenic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1045034285 8:98165334-98165356 CACTGTATACACCAGGTGGAGGG + Intergenic
1045357464 8:101402443-101402465 CAGTGTAGGCAGCTAGTGGAGGG + Intergenic
1045429534 8:102100623-102100645 CACATTAGCCAATAGGTGGAAGG + Intronic
1046820791 8:118632272-118632294 CACTTTGGGAGGCAGGTGGGTGG - Intergenic
1048876067 8:138837760-138837782 CACTTTAGGCACCAGTTTCATGG - Intronic
1049731453 8:144180613-144180635 CACTTTAGGCTGCAGGAAGGGGG + Intronic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1049908589 9:243671-243693 CACTTGAGGCTGCAGGGGAAAGG - Intronic
1049997382 9:1045818-1045840 CGACTTAGGCTGCAGGTGGAAGG + Intergenic
1050176869 9:2877323-2877345 CACTTGTGTCAGAAGGTGGAGGG + Intergenic
1050949244 9:11567002-11567024 CTCTTTAGTCAGCAGGTGATGGG + Intergenic
1052016157 9:23470403-23470425 CACTTTGGCAAGCAGCTGGACGG + Intergenic
1056515455 9:87345191-87345213 CAAATTAGGCAGCAGTGGGAAGG + Intergenic
1056734531 9:89196732-89196754 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1057250690 9:93499118-93499140 CAGATGAGGCAGCAGGTCGAGGG + Intronic
1059081830 9:111258082-111258104 CAGTTAAGGCAGGAGGTGGAAGG + Intergenic
1059251119 9:112889132-112889154 CACTTTGGGCGGGAGGTGGGAGG - Intronic
1059653247 9:116334610-116334632 GACTTTGGGCAGTAGGTGAAGGG + Intronic
1059925884 9:119208721-119208743 CTCTCTAGGCAGCTGGTGGTTGG + Exonic
1061147502 9:128808530-128808552 CACTCTGGGAAGGAGGTGGAAGG - Exonic
1186911709 X:14174393-14174415 CTCTTTAGTCAGCAGGTGATAGG + Intergenic
1187929257 X:24279085-24279107 CACTTTGGGAAGCAGGGGGCAGG - Intergenic
1187987843 X:24833843-24833865 CACTTTGGGAGGCAGGAGGATGG + Intronic
1189526065 X:41823279-41823301 TTCGATAGGCAGCAGGTGGAGGG - Intronic
1189592183 X:42525154-42525176 CACTTGAGCCAGGAGGTGGGAGG + Intergenic
1189606892 X:42688067-42688089 CAATTTTGGCTGCAAGTGGAAGG - Intergenic
1189870002 X:45371514-45371536 CTCTTTAGTCAGCAGGTGAAGGG - Intergenic
1190509990 X:51164954-51164976 GACTGTGGGCAGTAGGTGGATGG + Intergenic
1191826900 X:65375741-65375763 ATCTTTAGGCAGCAGGTGATGGG - Intronic
1191943535 X:66504682-66504704 CTCTTTAGTCAGCAGGTGATGGG - Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1192481626 X:71491254-71491276 CAGTTAAGGCAGGAGGTAGAAGG + Intronic
1192863644 X:75107216-75107238 CACTTTAGCCTGCAGGGGCAGGG - Intronic
1193246189 X:79232618-79232640 CACTTTAGTCAGCAGGTTACGGG + Intergenic
1193533876 X:82688786-82688808 TACTTCTGGCAGTAGGTGGAGGG - Intergenic
1193561444 X:83022503-83022525 CTCTTTAGTCAGCAGGTGATGGG - Intergenic
1194338731 X:92682528-92682550 CTCTTTAGTCAGCAGGTGATGGG + Intergenic
1195692476 X:107638673-107638695 CACTTTGGGGAGCAGGGGGCAGG - Intronic
1196035157 X:111135995-111136017 CACTTTAGGTAGAAGGTGGCAGG + Intronic
1197015976 X:121626779-121626801 CGCTTTAGTCAGCAGGTGATAGG - Intergenic
1197087938 X:122501400-122501422 CATTTGAGGAAGCAGGTGGATGG + Intergenic
1197252031 X:124226751-124226773 CACTTGAGCCAGGAGGTAGAGGG - Intronic
1198292995 X:135256981-135257003 CTCTTTAGTCAGCAGGTGATAGG - Intronic
1198435001 X:136608697-136608719 CATATCAGGCAGCAGGTGGCAGG + Intergenic
1200647120 Y:5799308-5799330 CTCTTTAGTCAGCAGGTGATGGG + Intergenic
1201987219 Y:19982437-19982459 CACTTTAGGAAGCTGGGGCAGGG + Intergenic