ID: 921327133

View in Genome Browser
Species Human (GRCh38)
Location 1:213997474-213997496
Sequence CCATTTCCTGCTCTCTGATC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921327133_921327135 2 Left 921327133 1:213997474-213997496 CCTGATCAGAGAGCAGGAAATGG 0: 1
1: 1
2: 1
3: 27
4: 252
Right 921327135 1:213997499-213997521 GAAAACAAGCCGAAGCGAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 123
921327133_921327138 27 Left 921327133 1:213997474-213997496 CCTGATCAGAGAGCAGGAAATGG 0: 1
1: 1
2: 1
3: 27
4: 252
Right 921327138 1:213997524-213997546 ACAACAAAGAAAGAGACCATGGG 0: 1
1: 0
2: 6
3: 50
4: 769
921327133_921327137 26 Left 921327133 1:213997474-213997496 CCTGATCAGAGAGCAGGAAATGG 0: 1
1: 1
2: 1
3: 27
4: 252
Right 921327137 1:213997523-213997545 AACAACAAAGAAAGAGACCATGG 0: 1
1: 1
2: 6
3: 122
4: 1219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921327133 Original CRISPR CCATTTCCTGCTCTCTGATC AGG (reversed) Exonic
900523666 1:3118277-3118299 CCATTTTCTGCACTCTGAGCAGG - Intronic
900616180 1:3566671-3566693 CCATTTCCAGCTGTTTGATGGGG - Intronic
901144302 1:7054706-7054728 CCACTTCCGGCTCTGTGACCCGG + Intronic
901560336 1:10065296-10065318 CTATATCCTGCTCCCTGACCTGG - Intronic
902153524 1:14464198-14464220 CTAGTTTCTGATCTCTGATCTGG - Intergenic
902230772 1:15026101-15026123 CCCTTTCCTTCTCCCTGACCTGG + Intronic
902941103 1:19800545-19800567 CCATTTCCTGCTTTCCATTCTGG + Intergenic
904101898 1:28037430-28037452 CTATTTCCTGGACTCAGATCTGG - Intronic
904998486 1:34649889-34649911 CCATTTACTGCTATGTGATTTGG + Intergenic
905093881 1:35452207-35452229 CCATTTCCTTTTCTTTCATCAGG - Intronic
907483489 1:54760745-54760767 CCACTGCCCCCTCTCTGATCAGG + Intronic
907525935 1:55054013-55054035 CCATTTCCTCCTCTGTAAGCAGG + Intronic
909016734 1:70388145-70388167 CCCTTTCCTGCACTGTGGTCTGG + Intergenic
909610023 1:77541721-77541743 CCGTTTCCTTCTCTCTAAGCTGG + Intronic
915042867 1:152983289-152983311 CCTTTTCCTCCTTTCTGATCAGG - Intergenic
915236246 1:154485095-154485117 CCATTTCCTCCCCTCGCATCTGG + Intronic
915517236 1:156420723-156420745 CCATTTCCCGCTCTCCCATTCGG + Intronic
915793064 1:158696059-158696081 CCCTTTCCTACTCCCTGAGCTGG - Intergenic
916770103 1:167899421-167899443 ACCTTAACTGCTCTCTGATCTGG + Exonic
917414263 1:174792051-174792073 GCATTTCCTGCACTGTAATCTGG - Intronic
920293742 1:204942968-204942990 CCAGTGCCTGCTCTCTGAGGGGG - Intronic
920999593 1:211029726-211029748 TTATTTCATCCTCTCTGATCTGG - Intronic
921327133 1:213997474-213997496 CCATTTCCTGCTCTCTGATCAGG - Exonic
922873718 1:228923580-228923602 CCATTCCCTGTTCTCTGCTCGGG + Intergenic
923270325 1:232349525-232349547 CCATTTCCTGTTGTCTGAAAAGG - Intergenic
924243631 1:242061765-242061787 CCTTTTCCTGCTCTGAGAACAGG - Intergenic
1062763579 10:45509-45531 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1064232810 10:13544345-13544367 CCTTTGCCTTCTCTCTGATATGG - Intergenic
1064348395 10:14554137-14554159 CCATTTCTAACTCTCTGAACAGG - Intronic
1065812886 10:29458708-29458730 CCATTTCCTCCTCAGTGATATGG - Intronic
1067165430 10:43863261-43863283 CCATGTCTTGCTCTATGATTTGG - Intergenic
1069664408 10:70145369-70145391 CCCTTTCCAGGTCTCAGATCTGG - Intronic
1071079972 10:81799194-81799216 CCACTTCCTGATCTATGATGTGG + Intergenic
1071717840 10:88114808-88114830 GCATTTCCTCCCCTCTGCTCAGG + Intergenic
1071971177 10:90908695-90908717 CCATTTCCTTCCCTCTCTTCAGG + Intergenic
1074727440 10:116326092-116326114 ACTTTTACTGCTCCCTGATCAGG - Intronic
1074821673 10:117184080-117184102 CCATTTCCTCCTCTCTAAAATGG + Intergenic
1076023747 10:127095149-127095171 CCCTCTTCTGCTCTCTGCTCTGG - Intronic
1076531704 10:131149331-131149353 TCCCTTCCTGCTCTCAGATCAGG + Intronic
1078625045 11:12947749-12947771 CCATTTCCTGCTACCTGTTATGG + Intergenic
1078668583 11:13345810-13345832 CCTGTTCCTGCTCTTGGATCAGG + Intronic
1080650090 11:34215312-34215334 CCCTTTCTTCCTCTCTGAGCTGG - Intronic
1081204232 11:40256324-40256346 CCATTTTCTACTCTCGGAACTGG + Intronic
1082687006 11:56251646-56251668 CCATTTCATGTCCTCTGTTCTGG - Intergenic
1082765854 11:57167114-57167136 CCTTTTCTGGCTCTCTGATCTGG - Intergenic
1083303066 11:61748806-61748828 CCATTTACTGATCACTGACCTGG + Intergenic
1085151373 11:74255030-74255052 TCATTTCCTGAGCTCTGAACAGG + Intronic
1086174396 11:83872575-83872597 CCATTTCTTCTTCTCTGATGAGG - Intronic
1089026916 11:115280485-115280507 CTGTTTCCTGCTTTCTTATCTGG - Intronic
1090164649 11:124534327-124534349 CCTTTTCCTGGACTCTGCTCTGG - Intergenic
1091900614 12:4141182-4141204 CCGTTTCCTGCTCTTTCACCTGG - Intergenic
1091913364 12:4249996-4250018 CCATTTCCTTCTCTGTAATATGG + Intergenic
1091938407 12:4451889-4451911 TCCTTTCCTGCTCTGAGATCTGG - Intergenic
1092435841 12:8446415-8446437 CCACCTCCTGCTCTATTATCGGG - Intergenic
1092771958 12:11904813-11904835 CCATTTCCTTCTCTAGGATTTGG + Intergenic
1093037336 12:14345177-14345199 CCTTGTGTTGCTCTCTGATCAGG + Intergenic
1093376195 12:18430686-18430708 CCATTGCCTCGTTTCTGATCAGG - Intronic
1094168504 12:27466590-27466612 CCATCTCCTGGCCTCTGATATGG - Intergenic
1097184135 12:57187573-57187595 CCCTTCCCTGCTGTGTGATCTGG + Intronic
1097416389 12:59321462-59321484 CCATTTCCAGGTCTCTGATTGGG + Intergenic
1098926171 12:76351182-76351204 CCCATTCTTGCTCTCTGCTCAGG - Intergenic
1100384292 12:94091512-94091534 CCATTGCTTGCTCTGTGACCAGG - Intergenic
1101643590 12:106607099-106607121 CCATTGCCTTCTTTATGATCTGG - Intronic
1102260906 12:111442773-111442795 CCTCTTCCTGCTCTCTCACCAGG + Intronic
1103042240 12:117705237-117705259 CCAGTTCCTGCTCTCTAGTATGG - Intronic
1103937103 12:124482581-124482603 CCATTTCTTCCTCACTGATCTGG - Intronic
1105449712 13:20488522-20488544 TCATTTCCTGCTCTAAGATTCGG - Intronic
1107450697 13:40506504-40506526 GCATTTCCTGCCCTCAGATCAGG + Intergenic
1109378674 13:61528209-61528231 ATATTTCCTGATCTCTGATGTGG - Intergenic
1112854681 13:103753225-103753247 CCATTTGCTGCTCTCTACTAGGG + Intergenic
1113712219 13:112474436-112474458 ATATTTCCTGCTCTCTGTGCAGG - Intergenic
1113791652 13:113032193-113032215 CCCTGTCCTGCTGTCTGAGCTGG + Intronic
1114271261 14:21101776-21101798 CCATTTCCTGATCTCTAAAGAGG + Intronic
1116083740 14:40207932-40207954 CCATTCCCTGCTTTGTCATCAGG + Intergenic
1116354258 14:43907670-43907692 ACATTTTCTTCTCTCTGTTCTGG + Intergenic
1118838343 14:69492604-69492626 CCATTCCCAGCTATGTGATCTGG + Intronic
1121416941 14:93786344-93786366 CCATCTTCTGCTCTCTTCTCTGG - Intronic
1122317962 14:100836686-100836708 CCATTTCCTCCTCTCCGAAGGGG - Intergenic
1124180904 15:27473151-27473173 GCATTTCCTACTCTCTGGGCTGG + Intronic
1128521743 15:68379927-68379949 GCATTTCCTGCTCTCTGATCTGG + Intronic
1128546727 15:68573472-68573494 CCCTTCCCTGCTCTCTGGCCTGG - Intergenic
1128703380 15:69820819-69820841 CCATTTCCTCCTCTCAGCTTTGG - Intergenic
1128792982 15:70446769-70446791 CCTTTTCCTTCTCTCAGTTCAGG + Intergenic
1128887500 15:71302378-71302400 CCATTTCCAGCTGTGTGTTCTGG - Intronic
1129232752 15:74205825-74205847 CCATTTCCTCCCCTCTGCTTAGG - Intronic
1129876826 15:78981028-78981050 CCATTTCCTGCTCTGAGCGCAGG - Intronic
1129937838 15:79465603-79465625 CAATTTCCTTCTGTCTGAGCCGG + Intronic
1131568145 15:93505371-93505393 CCATTTGATGGTCTCTGATATGG - Intergenic
1131618522 15:94042345-94042367 CCACTCCCTGGTCTCTTATCAGG - Intergenic
1132744939 16:1432653-1432675 CCCCTTCCTGCCCTCAGATCCGG + Intergenic
1133911690 16:10071901-10071923 CCATTTCCTTCTCTGTGAAATGG - Intronic
1134034611 16:11020298-11020320 CCATTGCGTGCTCTCAGAGCAGG - Exonic
1134265254 16:12686981-12687003 CCATTGCCCGCTTTCTGATGGGG + Intronic
1134854915 16:17510442-17510464 CCATTTATTCCTCTCTCATCAGG + Intergenic
1135972228 16:27080858-27080880 CCTTTTCCTTCTCTCTCTTCAGG + Intergenic
1137870783 16:51948051-51948073 CTATTCCCTGCTCACTGATGAGG - Intergenic
1138163440 16:54777422-54777444 GTCCTTCCTGCTCTCTGATCTGG - Intergenic
1139674173 16:68511492-68511514 CCATTTCCTGCCCCGTGGTCTGG + Intergenic
1141446748 16:84064248-84064270 ACATTCCCTGCTCTCTGTGCAGG + Intronic
1141586992 16:85040659-85040681 TCATTCCCTTCTCTCTGTTCAGG + Intronic
1142018448 16:87765294-87765316 CCATCTGCTGCTCACTGCTCAGG + Intronic
1142692073 17:1612666-1612688 ACATTCCCTGCCTTCTGATCTGG - Intronic
1143390673 17:6557363-6557385 CCATCTCCTGCTCTCTTTTGGGG - Intergenic
1143491376 17:7287002-7287024 TCCTGTCCTGCTCTCTGCTCTGG - Exonic
1143763826 17:9124401-9124423 CCACTTCCTGAACTCTGAGCAGG + Intronic
1144929568 17:18848459-18848481 CCATCTCCTGATATATGATCTGG + Intronic
1145989236 17:29068692-29068714 CCATTCCCTGCTATTTGATCTGG - Intergenic
1147139037 17:38451332-38451354 CCATTTCCTGCCCTCTAACCTGG - Intronic
1147540421 17:41352606-41352628 CCTTCTCCTGATCTCTGATTGGG - Intergenic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1148332167 17:46819434-46819456 GCATTTCCTGCTCTCGGAGTCGG + Intronic
1150487021 17:65550991-65551013 CCAGTTCCAGCTGTGTGATCTGG - Intronic
1151198794 17:72452606-72452628 CCACCTCCTGCTCTCTAAACAGG - Intergenic
1151656349 17:75498001-75498023 CCACTACCTCCTCTTTGATCTGG - Intronic
1151727572 17:75893621-75893643 CCGTTTCCTCCTCTGTGATGTGG - Intronic
1152956488 18:45840-45862 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1156042150 18:32834939-32834961 CCCTTTCCTGCACTCTTCTCTGG - Intergenic
1157320152 18:46628156-46628178 CCATTTTCTCCTCTCTGAAATGG + Intronic
1158426738 18:57347175-57347197 ACATCTCCAGCTCTCTGACCTGG + Intergenic
1160437196 18:78860716-78860738 CAATTGCCCCCTCTCTGATCTGG - Intergenic
1161048313 19:2149031-2149053 TCATTTGCTGCTCTCCAATCAGG + Intronic
1161574868 19:5049627-5049649 CCCTTCCCTGCTCTCTCACCAGG + Intronic
1165906654 19:39198350-39198372 CCATTTCCTGCTCTGTAAACAGG + Intronic
1167120014 19:47511251-47511273 GCACCTCCTCCTCTCTGATCTGG - Intronic
1167552247 19:50169241-50169263 CCACTGCCTGCTCTCTGGACAGG + Intergenic
1168422320 19:56212732-56212754 CCAATTCCTGTTCTCTCATGGGG + Intergenic
1168446779 19:56424772-56424794 CCATTTCCTGCCCTCTAATTTGG + Exonic
926323752 2:11766734-11766756 CCAGTTCCTGGGCTCTTATCAGG + Intronic
928314572 2:30235512-30235534 CCATTTCCTCATCTGTGAACAGG - Intronic
928391095 2:30911645-30911667 CCATTTCCTCCTCTCTGAAATGG - Intronic
928697530 2:33864499-33864521 CCATTTGCTGTTCTCTGCGCAGG - Intergenic
929580814 2:43080882-43080904 TCATTTCCAGCTCTCTGCTGTGG + Intergenic
930275765 2:49309521-49309543 CCATTTCATGCTTTCTTTTCTGG + Intergenic
930958043 2:57227801-57227823 CCATTGCCTGCTTTTTGATGTGG - Intergenic
931643633 2:64402876-64402898 CCATTTCCTCCTCCCTAATATGG + Intergenic
931779352 2:65566021-65566043 CCAAGGCCTGCTCTCAGATCTGG + Intergenic
932543005 2:72676593-72676615 TCATTTCCAGCTGTATGATCTGG + Intronic
933343397 2:81050913-81050935 CCATTTCCTTCTCTCTTCCCTGG + Intergenic
933433940 2:82220764-82220786 TCATTTCCTGCTCTATCACCAGG + Intergenic
935293358 2:101627986-101628008 GCATTTCCTGGTCTTTGACCAGG + Intergenic
935559465 2:104545289-104545311 TCATTTGCAGCTCTCTGCTCTGG - Intergenic
937781203 2:125840138-125840160 CCATGTACTGTTCTCTGATCAGG - Intergenic
938062170 2:128262531-128262553 CCATTTCCTTCTCTGTGAAATGG - Intronic
939627005 2:144490068-144490090 CCATTGTCTGCTTACTGATCAGG - Intronic
940179279 2:150914135-150914157 CCAGTTCCTGCTCCATGAACTGG - Intergenic
940473507 2:154130333-154130355 CCATCTCCAGCTCTCTGCTTCGG - Intronic
944565698 2:200988831-200988853 CCATTTTCTGCTCCCTGAAAAGG + Intronic
944848783 2:203695803-203695825 CCACTTATTGCTCTCTGGTCAGG - Intergenic
945626561 2:212214610-212214632 CCAGTTCTTGCTCTATGTTCTGG - Intronic
945816539 2:214611666-214611688 CCATTTCCTGACCTCTGTTTTGG + Intergenic
946299569 2:218814407-218814429 CAATTTCCTTTTCTATGATCCGG - Exonic
946343115 2:219084997-219085019 CCATTTCCTGCTTCCTAATGTGG + Intronic
946415253 2:219536963-219536985 CCATGTAGTGATCTCTGATCAGG + Intronic
947237870 2:227962725-227962747 CCATTTCCTGAGATCTTATCTGG - Intergenic
947624362 2:231610605-231610627 CCACTTCCTGCTGTCTGTTACGG - Intergenic
948332368 2:237179869-237179891 CCATGCCCTTCTCTCTGATTAGG - Intergenic
948974678 2:241457059-241457081 CCAGTACCTCCTCTCTGCTCAGG - Intronic
1170799452 20:19579011-19579033 GCCTTTCCTGCTCTCTAATTGGG + Intronic
1174365637 20:50054696-50054718 CCATTTCCTCATCTGTGAACGGG - Intergenic
1174766208 20:53256068-53256090 CAAATACCTGCTGTCTGATCTGG + Exonic
1176427653 21:6558705-6558727 CCATTTCCTGGTCTATGAAGCGG + Intergenic
1178018409 21:28379020-28379042 CAACTTTCTGCTTTCTGATCTGG - Intergenic
1179703145 21:43167022-43167044 CCATTTCCTGGTCTATGAAGCGG + Intergenic
1180110637 21:45647315-45647337 CCATTTCCTATGCTATGATCTGG + Intronic
1180165009 21:46020843-46020865 CCATTTGCTCATCTCTGATGTGG + Intergenic
1180857331 22:19056816-19056838 CCATTTGCAGCTCTGTGACCAGG - Intronic
1181470584 22:23136914-23136936 CTCTTTCCTGCTCTGTGATCTGG - Intronic
1182831239 22:33306232-33306254 CCCTCTCCTGGGCTCTGATCTGG + Intronic
1182965123 22:34514147-34514169 CCATTTCTTTCTCTCCGTTCTGG - Intergenic
1183192259 22:36329193-36329215 CCACACCCTGCTCTCTGATGTGG + Intronic
1183317313 22:37143779-37143801 CCATTTCCTCCTCTCTGAAGTGG - Intronic
1183827629 22:40400907-40400929 CCATCTCCACCTCTCTTATCTGG - Intronic
950834363 3:15905081-15905103 CCATTTCCTTCTCTGTAAACTGG - Intergenic
952183537 3:30944167-30944189 GCATTTCCAGCTCTCTAATCAGG - Intergenic
952597010 3:35029687-35029709 CCATCTCCTTCTCTCTGGCCTGG + Intergenic
953549480 3:43890290-43890312 CCATTTCCTCCTCTCTACTTGGG - Intergenic
954953017 3:54491608-54491630 TCATTTCCTGAACTCTGCTCTGG - Intronic
955485327 3:59428968-59428990 ACTTTTCCTGCTTTCTGATTAGG + Intergenic
956601480 3:71027378-71027400 TCATCTCCTGCTTTCTGGTCTGG - Intronic
956682578 3:71795084-71795106 CTATTTCCTGCTCTGTCACCTGG - Intergenic
957587775 3:82154941-82154963 CCCTTGCCTGCTCTTTCATCTGG + Intergenic
958838403 3:99172728-99172750 GCATTTGCTGCCCTCAGATCAGG + Intergenic
958959343 3:100494291-100494313 CCATCTACTGCTTTCTGAGCCGG - Intronic
960223257 3:115142295-115142317 CCATTTCCTGTTTTCTGGTAAGG - Intronic
961634828 3:128326624-128326646 CCATTTCCTCCTCTCAGCCCAGG + Intronic
962781514 3:138723184-138723206 CCATTTCCTGAAGTTTGATCTGG + Intronic
962785386 3:138763642-138763664 CCATTTCCAGCTGTCTGGTAAGG - Intronic
964577417 3:158188481-158188503 CCTCTTCCTGCTCTATCATCTGG + Intronic
965848079 3:172987911-172987933 CCATCTCCTGATCTCTGCTTGGG + Intronic
968357843 3:198122390-198122412 CCTTTTCCTGCTCTTAGAACAGG - Intergenic
969031821 4:4221728-4221750 TCATTTGCTGCTCTCTGTTTTGG - Intronic
969320997 4:6412562-6412584 CCTTTTCCAGCACTCAGATCAGG - Intronic
969523303 4:7691396-7691418 CCACTCCCTGCACTCTGGTCTGG - Intronic
969590992 4:8121894-8121916 CCATTTGCAGCTCTGTGACCTGG - Intronic
969764710 4:9219361-9219383 CCATTTCATGCTTTCTTATTTGG + Intergenic
969767756 4:9243087-9243109 CCATTTCATGCTTTCTTATTTGG + Intronic
969768362 4:9247836-9247858 CCATTTCATGCTTTCTTATTTGG + Intronic
969768966 4:9252586-9252608 CCATTTCATGCTTTCTTATTTGG + Intronic
969770187 4:9262081-9262103 CCATTTCATGCTTTCTTATTTGG + Intronic
970502421 4:16691527-16691549 CCATCTCCTTCTCTCTGTCCTGG - Intronic
971922242 4:32956330-32956352 CCACTTGCTGTTCTGTGATCTGG + Intergenic
972552432 4:40146805-40146827 TCATTTCCTCCTCTCTATTCTGG + Intronic
972726126 4:41747432-41747454 CCCTTTCCAGCTCTTTGAGCTGG + Exonic
973705822 4:53579321-53579343 CCCTTTCCTTCTTTCTGATCTGG + Intronic
974237599 4:59201821-59201843 CCATTTCCTTGTCTCTGCACTGG + Intergenic
975620041 4:76287738-76287760 ACCTTTCCTGCTTTCTGATGTGG + Intronic
975876162 4:78839427-78839449 AAATTTCCTGCTCTTTGATTTGG - Intronic
982263925 4:153521102-153521124 CACTTTCCGGCTCTGTGATCTGG + Intronic
984039491 4:174713151-174713173 GCACTTCCTGCTCTCTTATTAGG - Intronic
985717646 5:1471655-1471677 CCTCCTCCTGCTCTCTGACCAGG - Intronic
985717739 5:1472082-1472104 TTATCTCCTGCTCTCTGATCAGG - Intronic
986681294 5:10235179-10235201 CACTTTCCTGCTCTCTGTTTGGG - Intronic
991042283 5:62188323-62188345 CCCCTTCCTGCTCTGTGCTCAGG - Intergenic
991951979 5:71955232-71955254 CTATTTCTTCCTGTCTGATCTGG + Intergenic
996316957 5:122170749-122170771 AAATTTCCAGCCCTCTGATCAGG + Intronic
996556265 5:124782172-124782194 CCATTTCTTTCTCTGTGAACGGG + Intergenic
997705075 5:135942739-135942761 CCATTCCCTGCTCTTAGGTCAGG + Intronic
998432571 5:142078819-142078841 CCATTTCCTTCTCTGTGATATGG + Intergenic
998523981 5:142825782-142825804 AAGTTTCCTGCTCTCTGATCTGG - Intronic
999610752 5:153366697-153366719 CCATTTCCTGCTCTGTGAAGTGG + Intergenic
1002392025 5:178921619-178921641 CCTTTTCCTGCTCCATGAACCGG + Intronic
1002822736 6:742199-742221 CCATCTCCTGCCCTCTCCTCAGG - Intergenic
1003105137 6:3209666-3209688 CACTTTCCTGCTCTCTGACCTGG + Intergenic
1003859339 6:10307770-10307792 CCATTTCATGCTCTCTGCCTTGG - Intergenic
1005724225 6:28633376-28633398 CCATTTACTCCTTTCTGAACTGG + Intergenic
1006025790 6:31145796-31145818 CCCTCTCCAGCTCTCAGATCTGG - Exonic
1007633190 6:43283908-43283930 CCCTGTCCTGCTCTCTGAGGAGG + Exonic
1010881054 6:81172457-81172479 GCATTTCCTTCTCTGTGCTCAGG + Intergenic
1012091026 6:94897147-94897169 CCATTTTCTGCTTTATGATTAGG + Intergenic
1012428970 6:99144228-99144250 CCATTTCCTTCTTTCAGATGAGG - Intergenic
1014328889 6:120035024-120035046 CCATTTCATGCTCTTTAAACAGG + Intergenic
1014652292 6:124054663-124054685 TCCTTTGCTGATCTCTGATCAGG - Intronic
1016295557 6:142569890-142569912 CCATTTCCTTCTCTCTGAAGTGG + Intergenic
1016304370 6:142668204-142668226 TCATTTCCTGCTCCTAGATCAGG + Intergenic
1018793448 6:167168437-167168459 CCCTTCCCTTCTCTCTGATAAGG - Intronic
1018823265 6:167389941-167389963 CCCTTCCCTTCTCTCTGATAAGG + Intergenic
1019226374 6:170513570-170513592 TCCTTTCCTGCTTTCTGATCTGG - Intergenic
1019278766 7:189413-189435 CCACTCCCTGGTCTCTGATGGGG + Intergenic
1019607466 7:1917363-1917385 CCATGTCCTTATCTCTGGTCAGG - Intronic
1019616274 7:1964076-1964098 CCCTTACCAGCTCTGTGATCAGG - Intronic
1020116510 7:5479440-5479462 CCACTTCTTGCTCTCCGACCAGG - Intronic
1020338111 7:7080178-7080200 CCATTTCCTTCTCTATGATCAGG - Intergenic
1021285072 7:18770857-18770879 CCCTTTGCTTCTCACTGATCTGG - Intronic
1021494773 7:21261960-21261982 GTATTTCCTGCTTTCTGCTCTGG - Intergenic
1022103484 7:27182963-27182985 CCCGTTCCAGCTCTCGGATCTGG + Exonic
1023104432 7:36749737-36749759 CCATTCCCTGCCCCTTGATCTGG - Intergenic
1028523001 7:91752843-91752865 CCATTCCCTCCTCTCTGGGCTGG + Intronic
1029299804 7:99571666-99571688 CCATTTCCTTCTCTATGAGCAGG + Exonic
1031080122 7:117249860-117249882 CAGTTTCCTGCTCACTGAACTGG + Intergenic
1034495254 7:151417037-151417059 CCCGTTCCTGCTCTGTGGTCTGG - Intergenic
1035122107 7:156577390-156577412 TCATTTCCTGCTCCCAAATCAGG - Intergenic
1035630730 8:1104838-1104860 CCACTTCCTGCTCTCTGGTGAGG - Intergenic
1036653145 8:10658682-10658704 CCACTTCCTGCTGCCTGCTCTGG - Intronic
1037952259 8:23027201-23027223 CCATTTCCTGCTCAGGGACCTGG + Exonic
1043591292 8:81836094-81836116 TCATTTCTTGCTCACTGATATGG - Intronic
1046765904 8:118069407-118069429 CCATTTCCTCCTCCCTGGGCTGG + Intronic
1047663942 8:127069087-127069109 CCATCTCTTTCTCTCTGCTCAGG + Intergenic
1049264048 8:141657273-141657295 CCATTTTCTTCTCTCTCTTCTGG - Intergenic
1049330743 8:142049187-142049209 CAATTTCCTGCTGCCTGAACAGG + Intergenic
1049863944 8:144921175-144921197 CCATTTCTTGGTCTCTCAGCTGG + Intergenic
1055002042 9:71462488-71462510 CCATTTCCTCTTCTGTGATATGG - Intergenic
1055861931 9:80762050-80762072 GCATTTCCAGATCACTGATCAGG + Intergenic
1057552953 9:96065448-96065470 CCATTTCCTCATCTCTGAAATGG + Intergenic
1058184054 9:101833094-101833116 CCATTGCCTCCTCTGTTATCAGG + Intergenic
1059443174 9:114322417-114322439 CCATTCCCTGCCATCTGAGCAGG - Intergenic
1059444368 9:114329188-114329210 CCATTCCCTGCCATCTGAGCAGG - Intergenic
1060230509 9:121822116-121822138 CCACTTCCTTCTCTCGGAACGGG + Exonic
1061980688 9:134101844-134101866 CCAGTCCCTGCTCCCTGCTCAGG - Intergenic
1185724503 X:2408570-2408592 CCATCTCCTGCTCTAGGATGGGG + Intronic
1186166663 X:6833714-6833736 ACATTTACAGCTCTGTGATCTGG + Intergenic
1187391679 X:18890458-18890480 GCATTTCCTGCCTCCTGATCTGG + Intergenic
1192330607 X:70172631-70172653 TCATTCCCTGCTCTCTCCTCTGG - Intergenic
1196006422 X:110842332-110842354 CCAATTCCTGCTCCCTGACATGG - Intergenic
1196848927 X:119919055-119919077 TCATTTCCTGACCTCTGACCTGG - Intronic
1197586892 X:128359330-128359352 TCACTTCCTGCTCTCTGCTATGG - Intergenic
1199697316 X:150351986-150352008 CCAACTCCTGCTCTCCGCTCAGG - Intergenic
1199699812 X:150366721-150366743 CCAATGCCTGCTCCCTGCTCTGG + Intronic
1199703791 X:150406277-150406299 CCATTACCTGCTATGTGATGGGG - Intronic
1200742673 Y:6871065-6871087 CCTTTTCCTGCTCTCTAAGATGG - Intronic
1201250914 Y:12056834-12056856 CAGTTTCCTGGTCTCTGCTCAGG + Intergenic
1201758566 Y:17515302-17515324 CCTTTTCCTGCTCTGAGAACAGG + Intergenic
1201842989 Y:18390688-18390710 CCTTTTCCTGCTCTGAGAACAGG - Intergenic