ID: 921328664

View in Genome Browser
Species Human (GRCh38)
Location 1:214013766-214013788
Sequence CAGATAAAGGAGAGGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 334}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921328664_921328671 19 Left 921328664 1:214013766-214013788 CCAGGCCACCTCTCCTTTATCTG 0: 1
1: 0
2: 4
3: 25
4: 334
Right 921328671 1:214013808-214013830 GCTTCACTGCAAGGAGTATGGGG 0: 1
1: 0
2: 1
3: 10
4: 124
921328664_921328673 25 Left 921328664 1:214013766-214013788 CCAGGCCACCTCTCCTTTATCTG 0: 1
1: 0
2: 4
3: 25
4: 334
Right 921328673 1:214013814-214013836 CTGCAAGGAGTATGGGGCCCGGG 0: 1
1: 0
2: 2
3: 21
4: 236
921328664_921328672 24 Left 921328664 1:214013766-214013788 CCAGGCCACCTCTCCTTTATCTG 0: 1
1: 0
2: 4
3: 25
4: 334
Right 921328672 1:214013813-214013835 ACTGCAAGGAGTATGGGGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 210
921328664_921328668 10 Left 921328664 1:214013766-214013788 CCAGGCCACCTCTCCTTTATCTG 0: 1
1: 0
2: 4
3: 25
4: 334
Right 921328668 1:214013799-214013821 TTTAAGACTGCTTCACTGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 158
921328664_921328674 29 Left 921328664 1:214013766-214013788 CCAGGCCACCTCTCCTTTATCTG 0: 1
1: 0
2: 4
3: 25
4: 334
Right 921328674 1:214013818-214013840 AAGGAGTATGGGGCCCGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 208
921328664_921328669 17 Left 921328664 1:214013766-214013788 CCAGGCCACCTCTCCTTTATCTG 0: 1
1: 0
2: 4
3: 25
4: 334
Right 921328669 1:214013806-214013828 CTGCTTCACTGCAAGGAGTATGG 0: 1
1: 0
2: 0
3: 16
4: 172
921328664_921328670 18 Left 921328664 1:214013766-214013788 CCAGGCCACCTCTCCTTTATCTG 0: 1
1: 0
2: 4
3: 25
4: 334
Right 921328670 1:214013807-214013829 TGCTTCACTGCAAGGAGTATGGG 0: 1
1: 0
2: 1
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921328664 Original CRISPR CAGATAAAGGAGAGGTGGCC TGG (reversed) Intronic
900144530 1:1152169-1152191 CAGACCAAGGAGAGGTGACGAGG - Intergenic
901499281 1:9641617-9641639 CAGACAGCGCAGAGGTGGCCAGG - Intergenic
901648043 1:10727159-10727181 GGGAAAAGGGAGAGGTGGCCAGG + Intronic
902667493 1:17949748-17949770 CAGACAGAGGCGATGTGGCCCGG - Intergenic
903542134 1:24102377-24102399 CAGGAAAAGCAGAGCTGGCCAGG - Intronic
904371206 1:30048556-30048578 CAGCTCAGGGAGAGGTGGACAGG - Intergenic
904397540 1:30232253-30232275 CAGATACAGGAGAAGTTCCCGGG + Intergenic
904846248 1:33419902-33419924 CTTATAAGAGAGAGGTGGCCGGG - Intronic
905125727 1:35714928-35714950 AAGGGAAAGGAGAGGTGGCCTGG + Exonic
905242974 1:36593170-36593192 CAGATAAAGCAGAGATGCTCCGG + Intergenic
905551518 1:38844468-38844490 AAGAAACAGGAGAGGTGGTCGGG + Intronic
905595408 1:39202259-39202281 CAGATAAAGAATATGAGGCCGGG - Intronic
905674956 1:39818561-39818583 CATATAGAGGAGAGGTGAGCGGG + Intergenic
905702052 1:40024454-40024476 CAAAGAAAGCAGAAGTGGCCAGG - Intergenic
906668208 1:47636552-47636574 CAGAGAAAGGACAGGAGCCCAGG - Intergenic
907044296 1:51290397-51290419 GAGATAAAGGAGAGTTGCCAGGG + Intronic
907976360 1:59435021-59435043 CAGATAAAGATGAGGTGCTCAGG + Intronic
908491434 1:64648130-64648152 GAGATATAGGACAGGTGGCAGGG - Intronic
908999834 1:70205315-70205337 CAGAGAAAAGGGAGGTTGCCTGG + Intronic
910709172 1:90160925-90160947 CAGGTAAAGGAGTGGTGGAGGGG + Intergenic
912497613 1:110101638-110101660 CTGATAAAGAAGAGGTTGGCAGG - Intergenic
913056502 1:115166485-115166507 CATATAAAGGAGAGATGCCTTGG + Intergenic
913056639 1:115168095-115168117 GAGAGAATGGAGAGGTGGACGGG - Intergenic
915148487 1:153809985-153810007 GAAATAAAGGGGAGGTGGCAGGG + Exonic
915952882 1:160201568-160201590 CAGATAAGAGAGAGCTGGCCTGG - Exonic
916608161 1:166363553-166363575 CAGCTCTGGGAGAGGTGGCCAGG - Intergenic
917512545 1:175680292-175680314 CAGAAAAGGGAGAGGGGGCAGGG + Intronic
920393801 1:205629428-205629450 GATATAAAAGAGAGCTGGCCGGG + Intronic
920866969 1:209761253-209761275 CATAGACAGCAGAGGTGGCCTGG - Intronic
920966276 1:210704060-210704082 CAGGGCAAGGAGAGGTGCCCTGG + Intronic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
922179178 1:223220261-223220283 AAGAGAAAGGGGAGGGGGCCAGG - Intergenic
922238951 1:223742971-223742993 CAAACAAAGGGGAGGGGGCCTGG - Intronic
923499442 1:234552032-234552054 AAGATCAAAGAGAGTTGGCCGGG - Intergenic
1063361311 10:5461543-5461565 CAGAAAAAGGAGAGATGGAGGGG + Intergenic
1065483744 10:26217399-26217421 CAGATAAAGGAAATGAGGGCTGG + Intronic
1066053446 10:31659059-31659081 CAGAAAAAGGACAGGCGGACTGG + Intergenic
1066475677 10:35745460-35745482 CAGGTGGAGGAAAGGTGGCCTGG + Intergenic
1067415995 10:46103597-46103619 AAGATAACGGAGATATGGCCGGG - Intergenic
1067544036 10:47179079-47179101 CAGATAAAGCAGCTGAGGCCCGG - Intergenic
1069238159 10:66104247-66104269 CAGATAAAGTAGAGGGGGCTAGG - Intronic
1069656711 10:70095071-70095093 GAAAGAAAGGAGAGGGGGCCAGG + Intronic
1069872929 10:71544205-71544227 CAGATGCAGGAGAGGTGGACGGG + Intronic
1070406308 10:76100499-76100521 CAGATAAGGGAGAGGGTCCCTGG - Intronic
1070838875 10:79469380-79469402 CAGATGAAGCAGATGTGTCCTGG + Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1072960788 10:99927139-99927161 CAGATGGAGGAGGGGTGGCAAGG + Intronic
1073443653 10:103568166-103568188 CAGACAAAGGAGGTGGGGCCAGG - Intronic
1073548003 10:104369362-104369384 CAGAAATAGGAGAGGTTTCCAGG + Intronic
1074028310 10:109659819-109659841 TATATAAAGAAGAGGTGGGCCGG - Intergenic
1075222605 10:120598297-120598319 CAGAGAAAGCACAGATGGCCTGG + Exonic
1075372399 10:121948748-121948770 CAGATTAAGAAGAGGTCTCCAGG + Intergenic
1075445695 10:122511148-122511170 CAGATCAGGGAGTGGTGGCAGGG + Intronic
1075664576 10:124221409-124221431 CAGATAAAGGAAATGAGGCCGGG + Intergenic
1076309855 10:129497624-129497646 GAGACAAAGGAGAGATGGCAAGG - Intronic
1078087738 11:8244196-8244218 CACATATAGGAGAGGAGGCAGGG + Intronic
1079369430 11:19838029-19838051 CAGATAAAGGAGGGGAGGAGAGG + Intronic
1079995088 11:27287278-27287300 CAGAAAGAGGAGAGCTGGACAGG - Intergenic
1080800860 11:35609106-35609128 CAGAAAGAGGAGGGTTGGCCTGG - Intergenic
1083862567 11:65430266-65430288 CAGAAAAGGGAGAGGGGCCCAGG - Intergenic
1084106918 11:66986275-66986297 CAGAGAAGGGAGACATGGCCTGG - Intergenic
1084175799 11:67421474-67421496 CAGAAAGAGGAGAGGAGCCCGGG + Intronic
1084786819 11:71447454-71447476 CAGACAAAGGGGAGGTGCCCTGG + Intronic
1085910427 11:80818401-80818423 CAGATAAAGAGGAGGTGGAATGG - Intergenic
1087335625 11:96840614-96840636 CAGATAAAAGAGAGACGGACAGG - Intergenic
1087356857 11:97104602-97104624 ACAATAAAGGAGAGGTGGCATGG - Intergenic
1088789356 11:113210879-113210901 CAAACAGAGAAGAGGTGGCCAGG + Intronic
1089155378 11:116398057-116398079 GAGATGCAGGAGAAGTGGCCAGG + Intergenic
1089171667 11:116515957-116515979 CAGAAAACGTGGAGGTGGCCAGG - Intergenic
1089409645 11:118229797-118229819 CAGAGAAAGTGGAGCTGGCCTGG - Exonic
1089890083 11:121872134-121872156 CAGAAAAAGAAGAGGAGGCCGGG + Intergenic
1092459707 12:8675421-8675443 CAGTAAAAAGAGAGGTGGCCGGG - Intergenic
1092524051 12:9298681-9298703 AAGGCAAAGGAGAGGTGGCGGGG + Intergenic
1092543219 12:9433133-9433155 AAGGCAAAGGAGAGGTGGCGGGG - Intergenic
1092701142 12:11232180-11232202 CAGGTAAGGTAGAGGTGGACAGG + Intergenic
1094368092 12:29705570-29705592 CAGGTAATGGGGAGGTGACCTGG - Intronic
1094509801 12:31089305-31089327 AAGGCAAAGGAGAGGTGGCGGGG + Intronic
1096689162 12:53308868-53308890 GAGGGAAAGTAGAGGTGGCCAGG + Intronic
1096689215 12:53309164-53309186 CAGCTGAAGGAGTGGTAGCCAGG + Exonic
1097460187 12:59852055-59852077 AAGATAAAGTAGAGGTTGGCTGG + Intergenic
1098045538 12:66396813-66396835 AAGAGAAAGGAGATTTGGCCAGG + Intronic
1100825695 12:98472349-98472371 CAGAGAATGGAGAGGTGGGTTGG - Intergenic
1101617232 12:106350156-106350178 GTGATGAATGAGAGGTGGCCAGG + Intergenic
1102389646 12:112539304-112539326 CAGAGCAAGGAGAGATGGCTGGG - Intergenic
1105838490 13:24231995-24232017 CTGATAAAGGACAGGTGGCCAGG - Intronic
1105909810 13:24852640-24852662 TAGATATGGGAGATGTGGCCTGG + Intronic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1110291042 13:73806712-73806734 CAGATAAAGAAGCGGAGGCCTGG - Intronic
1110470788 13:75857437-75857459 CAGATAAAAGAGAGTTGACTGGG - Intronic
1110718408 13:78733630-78733652 CAGGAGAAGGAGAGGTGGCTTGG + Intergenic
1111224748 13:85254453-85254475 CAGTTAAGAGAGAGTTGGCCGGG - Intergenic
1112286153 13:98106159-98106181 CAGATAAAGGGGAGGGTCCCTGG - Intergenic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1112641002 13:101275100-101275122 CAGAAACAGGAGGCGTGGCCGGG - Intronic
1114192065 14:20447249-20447271 CAGATGAAGTAGAGGTGACCTGG - Exonic
1118055631 14:62076855-62076877 CAGGTAAATGGGAGGTGACCTGG - Intronic
1119139115 14:72249241-72249263 CTGGTTAAGAAGAGGTGGCCAGG + Intronic
1119667389 14:76494780-76494802 CAGTTAAAGCAGAGGAAGCCAGG + Intronic
1120744021 14:88137627-88137649 CAGATGGAGGAGTGGTGCCCAGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121614319 14:95302876-95302898 CAGAGAAAGGACAGGCTGCCTGG - Intronic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1123156292 14:106229931-106229953 CAAATAAAGGAAAGGTGGGTTGG - Intergenic
1123900712 15:24873740-24873762 CATAAAAAGAAGAGTTGGCCAGG - Intronic
1124839955 15:33232516-33232538 CAGTTAAAGCAGTGGCGGCCAGG + Intergenic
1126017754 15:44369131-44369153 CAGAAATAACAGAGGTGGCCGGG - Intronic
1126663210 15:51052318-51052340 CAGAAAAAGGAGAGGTCAGCTGG - Intergenic
1127503496 15:59576579-59576601 AAGAGAAAGAAGAGTTGGCCAGG + Intergenic
1127524531 15:59779272-59779294 CAGAGAAATGACAAGTGGCCTGG + Intergenic
1127682960 15:61315451-61315473 TAGATACTGCAGAGGTGGCCTGG + Intergenic
1128333141 15:66769420-66769442 CAGATGATGGAGAGGTGAACTGG - Intronic
1128920196 15:71603443-71603465 CAGATAAAGGGGAGGGTCCCTGG - Intronic
1129493914 15:75958305-75958327 AAAATAAGTGAGAGGTGGCCGGG - Intronic
1130230451 15:82092854-82092876 CAGGTCAAGGAAAGGGGGCCGGG + Intergenic
1130333150 15:82936846-82936868 TAGAAATAGGAGAGCTGGCCAGG - Intronic
1130926038 15:88386578-88386600 AAGATAAAGAAGAGGTGGACTGG + Intergenic
1131167306 15:90151784-90151806 AAGATACAGGAGACCTGGCCAGG + Intergenic
1131362875 15:91809596-91809618 CAAATAAAGGAGATGGGGCTGGG + Intergenic
1132393986 15:101459078-101459100 CTGGGAGAGGAGAGGTGGCCTGG - Intronic
1132498601 16:275141-275163 CACATAGGGGAGAGGAGGCCCGG - Intronic
1132670108 16:1099043-1099065 CAGCTGCAGGAGGGGTGGCCTGG - Intergenic
1132761867 16:1512354-1512376 CGGATATAGGAGCTGTGGCCTGG + Intronic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1133438463 16:5800529-5800551 CAAATAAGGGAGAGTTGGCTGGG + Intergenic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1135281167 16:21154840-21154862 CTGGTACAGGTGAGGTGGCCTGG - Intronic
1135798939 16:25474642-25474664 GAGCTGAAGGAGAGGTAGCCTGG - Intergenic
1136219859 16:28822035-28822057 CAGATAAGGGACAGGAGGGCCGG - Intergenic
1137812933 16:51370364-51370386 CAGGCAGAGGAGAGGAGGCCAGG - Intergenic
1137860602 16:51842647-51842669 GAGATAAAGGAGAGGTGAGGAGG - Intergenic
1138246771 16:55472869-55472891 TTGATAAAGGAGTGGTGGCAGGG - Intronic
1138435786 16:56999439-56999461 GACATAAAGGAGAGAAGGCCTGG - Intronic
1139423279 16:66862371-66862393 AAAATAAATGAGAGGGGGCCTGG + Intronic
1140088320 16:71816189-71816211 CAGAAGAAGGAGAGGTTGCTGGG + Intergenic
1140284727 16:73591396-73591418 AAAATAAAGCAGAGGGGGCCGGG + Intergenic
1141665712 16:85464123-85464145 CAGAGAGAGGAGGGGTGGGCGGG - Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1143191620 17:5044163-5044185 GAAAGAAAGGAAAGGTGGCCAGG - Intronic
1143343999 17:6236439-6236461 CTGATAAAGGTCAGGCGGCCGGG + Intergenic
1145183375 17:20772705-20772727 CAGATAAAACAAATGTGGCCAGG - Intergenic
1145721172 17:27074425-27074447 CAGACAAAGGGAAGGTAGCCTGG + Intergenic
1145733988 17:27213495-27213517 CAAAGAAGGGAGAGGTAGCCTGG - Intergenic
1145788720 17:27611005-27611027 CAGATACAGCACAGGTGACCGGG - Intronic
1147267640 17:39244488-39244510 CAGAGAGCTGAGAGGTGGCCGGG - Intergenic
1148646127 17:49220388-49220410 CAGATCCAAGAGAGGTGGGCTGG - Intronic
1149612552 17:57968165-57968187 CAGATAAAGGAGAAAAGGCTGGG - Intergenic
1149978041 17:61286324-61286346 CAGATGAAGCAGAGGTTGCTGGG + Intronic
1152177456 17:78797332-78797354 CATAAAAGGGAGAGGTGGCTGGG + Exonic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1152833414 17:82513293-82513315 AAAATTAAGGAAAGGTGGCCAGG - Intergenic
1153570567 18:6468062-6468084 CATTTAAAGAAGAGATGGCCGGG - Intergenic
1154191673 18:12235590-12235612 CAAATCATGGAGAGGTGGCTGGG + Intergenic
1154322774 18:13368136-13368158 CAGATAAAGGTGTGGAGCCCAGG + Intronic
1157493372 18:48138980-48139002 CAGATAAAGCACAGGCGGACTGG + Intronic
1158407508 18:57173214-57173236 CAGAGAAGGGTCAGGTGGCCAGG + Intergenic
1159519546 18:69500411-69500433 AGTATAATGGAGAGGTGGCCAGG - Intronic
1161017645 19:1991170-1991192 CAGGCAGAGGTGAGGTGGCCGGG + Intronic
1161142893 19:2659280-2659302 TAAATAAAGGAGAGGAGGGCCGG + Intronic
1161273763 19:3404402-3404424 CAGATAATGGGGAGGGGGCGCGG + Intronic
1161649668 19:5476703-5476725 AAAAAAAAGGAGAGGCGGCCGGG + Intergenic
1161776998 19:6269065-6269087 CAGAGAAAGGAAAGAGGGCCTGG + Intronic
1162662495 19:12181333-12181355 CAGATCAAGGAGAGTTAGGCCGG - Intronic
1162690769 19:12428472-12428494 CAGAGATTGGAGAGATGGCCTGG - Intronic
1162777494 19:12988761-12988783 AAAATGAAGGAGAGATGGCCGGG + Intergenic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164148982 19:22532577-22532599 CAGAGAAAGGAGGCGAGGCCAGG + Intergenic
1164806648 19:31122217-31122239 CAGAGTAAAGAGAGCTGGCCAGG - Intergenic
1166298875 19:41903215-41903237 TAGACAAAGGACAGCTGGCCGGG - Intronic
1167108322 19:47444187-47444209 CAGATAAAGAAGGGCGGGCCAGG - Intronic
1167600878 19:50454185-50454207 CAGAGAAAGCCGAGGTGGCTGGG + Intronic
1167633233 19:50638821-50638843 CACATAAATGAGAGGAGGCTAGG + Intronic
1167676387 19:50888799-50888821 CAAATAAAGGAGAAATGACCAGG + Intergenic
925020485 2:564203-564225 CAGAAAAAGGAAAGGTGGGAAGG + Intergenic
925356825 2:3247549-3247571 CTGATAAAGGGGAGGTTTCCTGG - Intronic
925369634 2:3335361-3335383 CAGAAAAAGCAGAGCTTGCCTGG + Intronic
926468944 2:13228346-13228368 CAGTTAAAGGACAGGAGGCAGGG - Intergenic
927476271 2:23416740-23416762 CAGAAAAAGGGAACGTGGCCAGG - Intronic
927889171 2:26737890-26737912 CAGATAAAGTGGTGGTGGCTGGG - Intergenic
929734957 2:44538072-44538094 CAGATAAAGAAAATGTGGCCGGG + Intronic
930750267 2:54927659-54927681 GGGATAAAGGTGGGGTGGCCTGG + Intronic
930870732 2:56168229-56168251 CAAAAAAAGGAGAGGTGGAAGGG - Intergenic
932891633 2:75601902-75601924 CAGATAAAGGGAAATTGGCCAGG - Intergenic
934060295 2:88286173-88286195 TAGAGAAAGGAGAGGAGCCCTGG + Intergenic
936261405 2:110962510-110962532 GAGATGAGGGAAAGGTGGCCGGG + Intronic
937053474 2:118911303-118911325 CAGTTCATGGAGAGGAGGCCTGG + Intergenic
937116840 2:119412357-119412379 TAGATAAAGGATACTTGGCCGGG - Intergenic
937118015 2:119422936-119422958 CAGTTAAAGGAGAGTAGGCCTGG - Intergenic
937261368 2:120588483-120588505 GAGACAAGGCAGAGGTGGCCAGG + Intergenic
939721825 2:145663239-145663261 AATATAAAGAAAAGGTGGCCGGG - Intergenic
940009266 2:149037937-149037959 TAGAGAGAGGACAGGTGGCCCGG + Intergenic
940397972 2:153214390-153214412 TAGAAAAAGGAGAGTTTGCCAGG + Intergenic
940865512 2:158813848-158813870 AAGAAAAAGGAAAGGAGGCCGGG - Intronic
941795794 2:169596996-169597018 CAGATAAAGAATATGTGGGCTGG - Intronic
941835207 2:170009398-170009420 CAGATAAGGGAGAGGAAGCAAGG + Intronic
942210659 2:173666123-173666145 CACTTAGAGCAGAGGTGGCCGGG - Intergenic
945154381 2:206823281-206823303 CAGCTAAAGGAAAGGTGGAAGGG + Intergenic
945233785 2:207615854-207615876 CAGCCTAAGGAGAGGTGGACTGG + Intronic
946169828 2:217888288-217888310 CAGATGGAGGAGAGGAGGGCAGG - Intronic
946422895 2:219574965-219574987 GAGAGAGAGCAGAGGTGGCCAGG - Exonic
947264628 2:228263547-228263569 CAGAGAAAGGAAAGCTTGCCTGG + Intergenic
947894585 2:233657453-233657475 GAGAAAAAGGAGGGGTTGCCAGG + Intronic
948293100 2:236841934-236841956 AGGATAAAGGATAGGTGGCTTGG - Intergenic
948430665 2:237916531-237916553 GTGGTAAAGGAGAGGTGGGCCGG + Intergenic
949034047 2:241808143-241808165 CAGGTAAAGGGAAAGTGGCCCGG + Intergenic
1170129728 20:13006254-13006276 CAGCTGAAGGAGAGGTGTCATGG + Intergenic
1170140600 20:13122105-13122127 GAGATGGAGGAAAGGTGGCCAGG - Intronic
1170790966 20:19509170-19509192 CAGATGAAGGAAATGAGGCCCGG + Intronic
1172217732 20:33248228-33248250 CCCATAAAAGAGAGGTGCCCAGG + Intergenic
1173058241 20:39636718-39636740 CAGCTAAAGGAGATAGGGCCAGG + Intergenic
1175763695 20:61578646-61578668 GAGATGGAGGAGAGGTGGCCAGG - Intronic
1180240364 21:46499403-46499425 CAGACAACAGAGAGGCGGCCAGG - Intronic
1182542796 22:31054133-31054155 CAGAAAAAGAGGAGGTGGCCAGG + Intergenic
1182950802 22:34373888-34373910 CTGATAAAGGAGAACTGGCTCGG + Intergenic
1183326596 22:37197956-37197978 CAGATAAACATGAGGAGGCCAGG + Intronic
1183339352 22:37271042-37271064 CAGAGAAAGGAGAGGCTGCAGGG + Intergenic
1183614640 22:38936465-38936487 CAGAGAAAGGGCAGGTGGCCAGG + Intergenic
1184112183 22:42401905-42401927 AAGATAAGGCAGAAGTGGCCAGG - Intronic
1184338063 22:43867140-43867162 TAGATAAATGTGAGGAGGCCAGG - Intergenic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
1185331420 22:50253661-50253683 CAGGGAAAGGGGAGGTGGCCAGG + Intronic
950153590 3:10707057-10707079 CAGGGCAAGGAGGGGTGGCCAGG + Intronic
952684407 3:36132180-36132202 CAAAGAAAGGAGGGGAGGCCTGG - Intergenic
953054792 3:39379549-39379571 AAGATAAAGAAAAGCTGGCCTGG + Intergenic
953926830 3:46986885-46986907 CTGAGACAGCAGAGGTGGCCAGG - Intronic
955697906 3:61655080-61655102 CTGATAAAGCGCAGGTGGCCGGG - Intronic
956360951 3:68446423-68446445 CAGATAGAAGGGAGGGGGCCAGG - Intronic
956599817 3:71008897-71008919 CAGAAAAAAGAGAGGTGGGGGGG - Intronic
957458628 3:80487807-80487829 AAAATACAGGAAAGGTGGCCAGG + Intergenic
960589473 3:119351613-119351635 AAAAAAAAAGAGAGGTGGCCTGG + Intronic
961727158 3:128939014-128939036 CAGATATAGCAGTGGTTGCCAGG + Intronic
962757346 3:138475624-138475646 CAGCTAAAAGAGTGGTAGCCAGG + Intronic
963074347 3:141332512-141332534 AACATAAAGGAGAGGTGGCCGGG - Intronic
964614553 3:158648734-158648756 CAGATAATGGAGGGCTAGCCAGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967833206 3:193940118-193940140 GAGAGAAAGGAGAGGTTGACAGG - Intergenic
967987625 3:195107176-195107198 CAAAAAGAAGAGAGGTGGCCGGG + Intronic
969573778 4:8024888-8024910 CAGACACCAGAGAGGTGGCCAGG + Intronic
971241511 4:24893238-24893260 CAGAAAAATGAAAGGTGGCTAGG + Intronic
971973789 4:33656809-33656831 CAGATAGAGCAGAGGGGGCGAGG - Intergenic
972678616 4:41284402-41284424 AAGCTACAGGAGAGGAGGCCGGG - Intergenic
972765570 4:42150770-42150792 GAGATAAAGGAGAGGAGTCGCGG + Intronic
973707074 4:53591629-53591651 CAGGTAAATGACAGGTGGGCGGG - Intronic
974374543 4:61059605-61059627 TAGAAGAAGGCGAGGTGGCCAGG - Intergenic
975032611 4:69640121-69640143 CAGATCAAGAAGATATGGCCTGG + Intronic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
981022432 4:140042801-140042823 CTGTTAGAGGAGAGGTGTCCTGG + Intronic
981025571 4:140073836-140073858 CAGAAAGAGGACACGTGGCCAGG + Intronic
981569801 4:146139417-146139439 CAGATAAAGGACAAATGGCAGGG - Intergenic
982027573 4:151266499-151266521 CATATGAAGAAGAGGTGCCCTGG + Intronic
982605347 4:157509438-157509460 TAGAAAAAGGAGAGGAGGCAGGG - Intergenic
983471008 4:168154480-168154502 AAGATAAAGCAGTGGTGGCCAGG + Intronic
984821938 4:183889748-183889770 TAGAAAGAGGGGAGGTGGCCTGG - Intronic
985812728 5:2101957-2101979 CATGTAAGGGAGAGGTGGGCAGG - Intergenic
986196642 5:5542836-5542858 CAGATAAAGGCGAGCTGGTGAGG + Intergenic
988489780 5:31696595-31696617 TCAATTAAGGAGAGGTGGCCAGG - Intronic
991943203 5:71875074-71875096 CAGAAATAGGAGAGGCTGCCAGG - Intergenic
992432960 5:76727525-76727547 CAGACAATGAAGGGGTGGCCTGG - Intronic
992837364 5:80654397-80654419 CAGATACCTGAGCGGTGGCCAGG + Exonic
995601235 5:113799068-113799090 CAGCTAAAAGTGTGGTGGCCTGG - Intergenic
996305399 5:122040682-122040704 ATGATAAAGGAGAGGTTGTCAGG + Intronic
997242610 5:132318846-132318868 CAGATAGAGCATAGGGGGCCAGG + Intronic
997286008 5:132679069-132679091 CAGATCAGGGAAAGGTGTCCTGG - Intronic
999407106 5:151316443-151316465 CATATAAAAGAGATCTGGCCAGG + Exonic
999618203 5:153447815-153447837 CAGATTAAAAAGAGGGGGCCGGG - Intergenic
1000079961 5:157835638-157835660 CAGAGAAGGGAGAGGTGGAAAGG + Intronic
1000325680 5:160170334-160170356 AAGATAAAGGAATTGTGGCCGGG + Intergenic
1000408850 5:160917311-160917333 CACATGAATGAGTGGTGGCCTGG - Intergenic
1000556481 5:162732558-162732580 CAGATAAAGGAGAGGGCCCCTGG - Intergenic
1001096044 5:168776206-168776228 CAGCTAAGGGAGAGGTGGCATGG - Intronic
1002254300 5:177947916-177947938 CAGATAAAGGAGCGGTTCCTGGG - Intergenic
1002483696 5:179519896-179519918 CAGATAAAGGAGCGGTTCCTGGG + Intergenic
1003071283 6:2947390-2947412 CAGGTAAAGGAGGAGAGGCCAGG + Intergenic
1003095320 6:3138311-3138333 CAGATAAAGAATAGGAGGCTGGG - Intronic
1003146460 6:3514449-3514471 TAGATACAGGAGAGGAGGCAGGG + Intergenic
1003375312 6:5571742-5571764 CTGATAAAAGAAAGGTGGCTAGG - Intronic
1003535844 6:6974534-6974556 GAGATTAAGAAGACGTGGCCGGG - Intergenic
1004012454 6:11702687-11702709 CAGAGAAAGGAGGTGAGGCCAGG + Intergenic
1004121069 6:12822575-12822597 CAGGGAAGGGAGAGGAGGCCTGG - Intronic
1004285408 6:14316588-14316610 CAGTGAAAGGAGAGCAGGCCGGG + Intergenic
1004334776 6:14754810-14754832 CATATGAGGGAGAGGTGGCAGGG + Intergenic
1004926143 6:20416890-20416912 CATTTAAAGGAGGGGTGGCCAGG - Intronic
1005145083 6:22680337-22680359 TAGATAAATGAGTGGTGGACAGG - Intergenic
1005685511 6:28249998-28250020 CTGAAAACGGAGATGTGGCCCGG + Intronic
1005981590 6:30840889-30840911 CAGATAAAGGGGAGGGTCCCTGG - Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1012924262 6:105251653-105251675 CAGATAAAGTAGGGGTGGCTGGG + Intergenic
1014271387 6:119340384-119340406 CAGAAATAGGACAGGAGGCCAGG - Intronic
1015161382 6:130156041-130156063 AAGAAAAAGGAAAGGAGGCCAGG + Intronic
1015229160 6:130894052-130894074 CAGACAAAGGAGATGAGGCAAGG + Intronic
1018088580 6:160326052-160326074 CAGGGAGAGGAGAGGTGGCAAGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019951110 7:4373476-4373498 CATAAAAAGAAGAGATGGCCTGG - Intergenic
1021205260 7:17772480-17772502 CTGAGAATGGAGAGGTGGACTGG + Intergenic
1022025017 7:26440384-26440406 CAGATGAATGAGAGGTGTCAAGG - Intergenic
1022680083 7:32536709-32536731 CAGACAGAGGTGGGGTGGCCTGG - Intronic
1023344866 7:39261205-39261227 CAGGAGCAGGAGAGGTGGCCTGG - Intronic
1025237224 7:57243034-57243056 TAGTTAAAGGAGAGATGGCTGGG + Intergenic
1025319425 7:58078347-58078369 CAGAGAACAGTGAGGTGGCCAGG + Intergenic
1026351379 7:69518397-69518419 CAGACAAAGGGGAGCTGGCCAGG + Intergenic
1026623384 7:71971151-71971173 CAAAGAAAGGAGATGAGGCCAGG + Intronic
1026683350 7:72487388-72487410 GAGAAAATAGAGAGGTGGCCAGG + Intergenic
1026736532 7:72952511-72952533 AAGAGAAAGGAGTGGAGGCCGGG + Intergenic
1026802224 7:73407513-73407535 AAGAAAAAGGAAAGGAGGCCGGG + Intergenic
1027107202 7:75412551-75412573 AAGAGAAAGGAGTGGAGGCCGGG - Intergenic
1028220029 7:88186263-88186285 GAGCCAAATGAGAGGTGGCCTGG + Intronic
1028473234 7:91226948-91226970 CAGCTAGAGGAAAGGAGGCCCGG - Intergenic
1028768750 7:94590695-94590717 GAGATAAATGTGAGGTTGCCTGG + Intronic
1029571179 7:101370666-101370688 TAGATGAAGGAAAGGTGGGCAGG - Intronic
1029712371 7:102306863-102306885 CACCTAAAGGGAAGGTGGCCTGG - Intronic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030152350 7:106420154-106420176 CAGAGAATGGAGAGGTGGGGAGG - Intergenic
1032080166 7:128854680-128854702 CAGGTAAGGGGCAGGTGGCCAGG + Exonic
1032767833 7:135016575-135016597 TAGCTAAAGGAGAAGTGGCAGGG + Intronic
1032825372 7:135563125-135563147 GATATGAAGGAGAGGTAGCCAGG - Intronic
1032838286 7:135693794-135693816 CTGAGCAATGAGAGGTGGCCTGG + Intronic
1036044016 8:5119813-5119835 CAGACCAAGGAGAGGTACCCAGG - Intergenic
1036419516 8:8582918-8582940 CAGAAAAACGTGAGGTTGCCAGG + Intergenic
1037915555 8:22770708-22770730 CTGATCAAGGAGAGGTGGGATGG - Intronic
1037916991 8:22778788-22778810 CAGAGCAAGGAGAGAAGGCCAGG - Intronic
1038678157 8:29642382-29642404 AAGATAAGGGACATGTGGCCTGG + Intergenic
1040399065 8:47029953-47029975 GAGAGAAAGGAGAGGTGGGGTGG + Intergenic
1040638416 8:49302867-49302889 CAGAGAAAGGAGACATGGCCTGG + Intergenic
1041263108 8:56038686-56038708 AAGATAGAGGAGCGGTTGCCTGG - Intergenic
1041347292 8:56912731-56912753 CAGAGAAAGTAGAAGTGCCCAGG - Intergenic
1042668248 8:71231500-71231522 CAGATTGGGGAGAGGTGGCAAGG - Intronic
1042724230 8:71855233-71855255 CAGATAAACTAGTGGTTGCCAGG - Intronic
1045196343 8:99934842-99934864 CGGATAAAGAAAAGGAGGCCGGG + Intergenic
1045494992 8:102700633-102700655 CAGAGAAAGGAGAGCTTACCAGG - Intergenic
1045703754 8:104896784-104896806 CAGATACAGGAGTGGGGGCTAGG - Intronic
1047758865 8:127939325-127939347 CAGATGGAGCAGAGGTGGACAGG + Intergenic
1048281426 8:133108284-133108306 TAGATAAAGGAGTGGTCCCCAGG - Intronic
1048703666 8:137124847-137124869 CAGACAAAAGAGAGGTGCACAGG - Intergenic
1048891684 8:138954008-138954030 TAGATAAAGGAAATGAGGCCTGG + Intergenic
1049539693 8:143202623-143202645 CAGAAAAAGCAGTGATGGCCTGG - Intergenic
1051663472 9:19446427-19446449 CTGCTAATGGGGAGGTGGCCGGG + Intronic
1054337134 9:63817337-63817359 CACAGAAAGGAGAACTGGCCTGG + Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1059046816 9:110878088-110878110 AAGATAAAGGAGAGGAATCCAGG - Intronic
1059431484 9:114252973-114252995 CAGATAAGGGTTAGGTGGCTGGG + Intronic
1060353486 9:122881189-122881211 CAAAGAAAGGTGAGGAGGCCAGG + Intronic
1060942048 9:127548358-127548380 CAGCTAAGGGAGAGGCGGCAAGG - Intronic
1061933255 9:133844130-133844152 CAGACAAAGTAGAGGGGGCAGGG - Intronic
1062287719 9:135780532-135780554 CAGAGAAGCGAGAGGAGGCCGGG + Intronic
1185661636 X:1733203-1733225 GAAAAAAAGGAGAGGGGGCCGGG + Intergenic
1186341290 X:8648999-8649021 CTGATAAAGGAGATGCTGCCTGG - Intronic
1187504956 X:19871954-19871976 CAGGTAAAAGAATGGTGGCCGGG + Intronic
1189140703 X:38602682-38602704 AAGAGAATGGAGAGGTGGGCGGG + Intronic
1189393802 X:40602353-40602375 TAAATAAAGAAGAGGAGGCCGGG + Intronic
1190086171 X:47397182-47397204 AAGATAAAGAAGAGTAGGCCTGG - Intronic
1190224941 X:48538107-48538129 CAGTTGAAAGAGAAGTGGCCAGG - Intergenic
1190232185 X:48590651-48590673 CAGATTGAGGAGAGGGGGCGAGG + Intronic
1190915311 X:54807903-54807925 CAGCTGAAGCAGAGGTGACCTGG + Intronic
1191666977 X:63713535-63713557 CAGATAAAGGAGAGATTGGAGGG + Intronic
1195323866 X:103742555-103742577 GAGAGAAAGAAGAGGAGGCCTGG - Intergenic
1196815273 X:119660731-119660753 TATAAAAAGCAGAGGTGGCCAGG + Intronic
1198068574 X:133124907-133124929 CAGAGAAAGGGGAGGGGGCATGG + Intergenic
1199299503 X:146196486-146196508 CAGCTAAATGAGATGGGGCCTGG - Intergenic
1199712373 X:150478664-150478686 CAGATAAAGGACTGGGGACCAGG + Intronic
1199729535 X:150617827-150617849 CAGATAAAGGAGTGCTGTGCTGG - Intronic
1199819148 X:151427417-151427439 CAGGTGAAGGAGAGGAGTCCAGG + Intergenic
1201437566 Y:13975809-13975831 GAGATAAAAGAGAGGGGGCTGGG - Intergenic