ID: 921329928

View in Genome Browser
Species Human (GRCh38)
Location 1:214025344-214025366
Sequence CAGCTTTTCTAGAGGCCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 144}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921329928_921329937 21 Left 921329928 1:214025344-214025366 CCATTAGGCCTCTAGAAAAGCTG 0: 1
1: 0
2: 1
3: 17
4: 144
Right 921329937 1:214025388-214025410 AAGCAGGGGCTGGCAAAGTATGG 0: 1
1: 1
2: 3
3: 77
4: 496
921329928_921329930 -6 Left 921329928 1:214025344-214025366 CCATTAGGCCTCTAGAAAAGCTG 0: 1
1: 0
2: 1
3: 17
4: 144
Right 921329930 1:214025361-214025383 AAGCTGTTAGCCCTCAAGTTTGG 0: 1
1: 0
2: 1
3: 6
4: 88
921329928_921329933 5 Left 921329928 1:214025344-214025366 CCATTAGGCCTCTAGAAAAGCTG 0: 1
1: 0
2: 1
3: 17
4: 144
Right 921329933 1:214025372-214025394 CCTCAAGTTTGGCTAAAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 114
921329928_921329935 7 Left 921329928 1:214025344-214025366 CCATTAGGCCTCTAGAAAAGCTG 0: 1
1: 0
2: 1
3: 17
4: 144
Right 921329935 1:214025374-214025396 TCAAGTTTGGCTAAAAGCAGGGG 0: 1
1: 0
2: 1
3: 23
4: 154
921329928_921329934 6 Left 921329928 1:214025344-214025366 CCATTAGGCCTCTAGAAAAGCTG 0: 1
1: 0
2: 1
3: 17
4: 144
Right 921329934 1:214025373-214025395 CTCAAGTTTGGCTAAAAGCAGGG 0: 1
1: 0
2: 1
3: 16
4: 141
921329928_921329939 29 Left 921329928 1:214025344-214025366 CCATTAGGCCTCTAGAAAAGCTG 0: 1
1: 0
2: 1
3: 17
4: 144
Right 921329939 1:214025396-214025418 GCTGGCAAAGTATGGCCTATGGG 0: 1
1: 0
2: 10
3: 99
4: 348
921329928_921329936 11 Left 921329928 1:214025344-214025366 CCATTAGGCCTCTAGAAAAGCTG 0: 1
1: 0
2: 1
3: 17
4: 144
Right 921329936 1:214025378-214025400 GTTTGGCTAAAAGCAGGGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 179
921329928_921329938 28 Left 921329928 1:214025344-214025366 CCATTAGGCCTCTAGAAAAGCTG 0: 1
1: 0
2: 1
3: 17
4: 144
Right 921329938 1:214025395-214025417 GGCTGGCAAAGTATGGCCTATGG 0: 1
1: 0
2: 11
3: 95
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921329928 Original CRISPR CAGCTTTTCTAGAGGCCTAA TGG (reversed) Intronic
900483588 1:2910941-2910963 CATCTTGTCTGGAGGCCTGAGGG + Intergenic
901178118 1:7319483-7319505 CAGCTTTTGGGGAGGCCTCAGGG - Intronic
901753186 1:11424580-11424602 CAGCTTCTCGGGAGGCCTTAAGG - Intergenic
903185493 1:21626628-21626650 CTGCTTGGCTGGAGGCCTAATGG - Intronic
906776596 1:48535264-48535286 CAGCCTCTGCAGAGGCCTAAAGG - Intronic
912861020 1:113214027-113214049 CAGCTTTTAGGGAGGCCTCAGGG + Intergenic
918203033 1:182285062-182285084 CAGCTTTGCTACAGGCCTGGAGG + Intergenic
919580244 1:199363289-199363311 CAGCTTCTGTAAAGGCCTCAGGG - Intergenic
921329928 1:214025344-214025366 CAGCTTTTCTAGAGGCCTAATGG - Intronic
922130900 1:222776685-222776707 AAGCTTTTATAGAAGACTAAAGG + Intergenic
1066081899 10:31938974-31938996 GAGGTTTTCCAGAGGCCCAAAGG - Intergenic
1066330306 10:34414484-34414506 CAGCTTTTATAGAAACCTTAGGG - Intronic
1069840841 10:71338355-71338377 CAGCATTTCCAGAGGCCTATGGG - Intronic
1071392219 10:85187356-85187378 CAGATTTTCTAAATGCCTTAAGG - Intergenic
1072396391 10:95047140-95047162 CAGCTTTTGGAGAGTCCTCAGGG - Intronic
1073447760 10:103591461-103591483 CAGCATTTCTAGGGGCCCAGAGG - Exonic
1074927299 10:118086208-118086230 CAGCTTCTACAGAGGCCTCAGGG + Intergenic
1075082269 10:119391837-119391859 CAGCTTTTCCAGAGTCCTTGAGG - Intronic
1078875191 11:15387384-15387406 CAACTTTTCCAGGGGCCTATGGG - Intergenic
1079737164 11:24011882-24011904 CAGCTTGTGGAGAGGCCTCAGGG - Intergenic
1080878759 11:36300246-36300268 CAGCTTTTGGTGAGGCCTCAGGG + Intronic
1085443893 11:76588319-76588341 CAGGCCTTCTAGAGGCCTCAGGG - Intergenic
1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG + Intergenic
1086878786 11:92129978-92130000 CAGCCTTTCTACAGTCCCAAAGG + Intergenic
1087397462 11:97619089-97619111 CAGCTTCTGTGGAGGCCTCAAGG - Intergenic
1088460399 11:110076375-110076397 CAGCTTCTGGGGAGGCCTAAGGG + Intergenic
1088528917 11:110786796-110786818 CAGCTTCTGGAGAGGCCTAAGGG - Intergenic
1090363916 11:126190764-126190786 CTGTTTTTCTAGAGTCCTAATGG - Intergenic
1090697839 11:129266780-129266802 CAGCTATGCTAAGGGCCTAAAGG + Intronic
1092804977 12:12213024-12213046 CAGCTTCTTTAGAGGACTAATGG + Intronic
1096720031 12:53514346-53514368 TGGCGTTTCTAGAGGCCTAAGGG - Exonic
1099475464 12:83103427-83103449 CAGCTTCTCAGGAGGCCTCAAGG + Intronic
1103443628 12:120980392-120980414 CTGCTTTCCCAGAGGCCTCAGGG + Intronic
1105407725 13:20145675-20145697 CAGCATGTACAGAGGCCTAAAGG - Intronic
1108670610 13:52684292-52684314 CAGCCTTGCTAGAGGTTTAAAGG + Intronic
1111769626 13:92580601-92580623 TGGCTTTTCGAGAGGCCTCAGGG + Intronic
1112283754 13:98085720-98085742 CAGCATTTTTGGAGGCCGAAGGG - Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1116267411 14:42711414-42711436 CAGCTTCTGGGGAGGCCTAAGGG - Intergenic
1118082142 14:62372851-62372873 CATCTTCTCTAGAGCCCTATGGG - Intergenic
1120008625 14:79388225-79388247 CAGGTTTTGGAGAGGCCTCAGGG - Intronic
1120420402 14:84278180-84278202 CAGCTATTCTATAGCCTTAAAGG - Intergenic
1131215731 15:90533820-90533842 CACCTCTTCCAGTGGCCTAAAGG + Intronic
1131771773 15:95745670-95745692 CAGCTTCTGTAGAGGCCTCAGGG + Intergenic
1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG + Intronic
1136526512 16:30834684-30834706 CCGCCTTGCTAGAGGCCTAGGGG - Exonic
1137333668 16:47526906-47526928 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
1141008032 16:80371515-80371537 CAGCGTGTGTAGAGGCCTAGGGG - Intergenic
1143094802 17:4472900-4472922 CAGCTATTCCAGAGGCTGAAGGG - Intronic
1149271182 17:54979447-54979469 TAGCTTTTCCAGGGGCATAAAGG - Intronic
1150934304 17:69618490-69618512 CATCTTGTCCAGAGGCCTCATGG - Intergenic
1152886172 17:82851699-82851721 CAGCTCTTCGAGAGGGCTGATGG + Intronic
1153170228 18:2307942-2307964 CAGCTTCTCAGGAGGCCTCAGGG - Intergenic
1153680100 18:7492351-7492373 TGGCTTATCTAGAGGTCTAATGG + Intergenic
1154333747 18:13450197-13450219 CCGCTGATCTAGAGGCCTCATGG - Intronic
1155170573 18:23264238-23264260 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1159542770 18:69800411-69800433 TATCTTTTCCAGAGGCATAATGG - Intronic
1161049153 19:2153123-2153145 CAGCACTTCGGGAGGCCTAAAGG + Intronic
1162575798 19:11498042-11498064 CAGCTTTTGCAGAGCCCTAAGGG - Intronic
1164269583 19:23659784-23659806 CTGCTTTTCCAGAGGCCCAGAGG + Intronic
1164285369 19:23810752-23810774 CTGCTCTTCCAGAGGCCTAGAGG - Intronic
1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG + Intronic
926849146 2:17175557-17175579 CAGCTTCTGGAGAGGCCTCAAGG + Intergenic
928571617 2:32615019-32615041 CTGCTTCTGTAGAGGCCTCAAGG + Intronic
929725299 2:44419534-44419556 TATCTGTTCTAGAGGCCTAGAGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG + Intergenic
936095305 2:109526640-109526662 CAGACTTTCTGGAGGCCCAAGGG + Intergenic
936107405 2:109636822-109636844 CAGCTATTCAAGAGGCTGAAGGG + Intergenic
937583546 2:123518581-123518603 TAGATTTTTTATAGGCCTAATGG + Intergenic
937686083 2:124698816-124698838 CAGGTTTTCTAATGGCCTAGGGG - Intronic
941668850 2:168269111-168269133 CAGATTTTGGAGAGGACTAAAGG - Intergenic
942382594 2:175407431-175407453 CAGCTTTTCTACAAGCATTAGGG - Intergenic
942625168 2:177892910-177892932 CAGCTTTTCTAGAGTCCCAAAGG - Intronic
942915525 2:181301345-181301367 CACCTTTTCTACATACCTAATGG + Intergenic
944491676 2:200263841-200263863 CTGCTTTTGTGGAGGCCTCAGGG - Intergenic
944898613 2:204191413-204191435 CTGCTTTTCCAGGGGCTTAAAGG + Intergenic
945639962 2:212412506-212412528 CAGCTTCTGGAGAGGCCTCAGGG - Intronic
948130008 2:235593197-235593219 CAGCTTTTCCTGAGCCCTCAAGG + Intronic
1169621269 20:7509068-7509090 CAGCTTCTGTGGAGGCCTCATGG + Intergenic
1169881951 20:10356554-10356576 CAGCATTTCTAGAGTCCAACAGG + Intergenic
1170076892 20:12429351-12429373 CAGCTAGTCTAGAGGCCTGGAGG + Intergenic
1170321276 20:15100867-15100889 CAGCACTGTTAGAGGCCTAAGGG - Intronic
1175767413 20:61601132-61601154 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
1175865354 20:62173038-62173060 CAACTTTTCTGGAAACCTAAAGG - Intronic
1176034644 20:63030283-63030305 CAGCTTTCCAAGGGGACTAACGG - Intergenic
1179048124 21:37865027-37865049 CAGCTTCTCTTGAAGCCTCATGG - Intronic
1181369522 22:22405072-22405094 GAGCTTCACTAGAGGCCTGAGGG + Intergenic
1182938467 22:34249995-34250017 CAGCTTTTAGGGAGGCCTCAGGG - Intergenic
1184345476 22:43910159-43910181 CAGGTTTTCTAGAAGTCAAAGGG - Intergenic
949219980 3:1620424-1620446 CCGCTATTCTAGAGGTGTAAGGG - Intergenic
949267426 3:2174771-2174793 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
950308258 3:11933602-11933624 CAGCTTCTCGGGAGGCCTCAGGG + Intergenic
950346653 3:12301193-12301215 CAGGTTTTTTAATGGCCTAAGGG + Intronic
951346003 3:21547492-21547514 GAGCTTCCCTAGAGGCCTAAGGG - Intronic
951724996 3:25747973-25747995 CATCTTTTCTAGAGCCACAAAGG - Intronic
954581754 3:51706894-51706916 CAGCTTTTCTGGGGACCTCAGGG - Intergenic
967594052 3:191309828-191309850 CAGCTTGTGGAGAGGCCTCAGGG - Intronic
969951655 4:10843223-10843245 CAGCTTCTTTGGAGGCCTCAAGG + Intergenic
971386905 4:26149133-26149155 CAGTTTTTCCAGAGTCATAAGGG + Intergenic
972260614 4:37404738-37404760 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
977612678 4:99052431-99052453 CAGCTTCTGGAGAGGCCTCAGGG + Intronic
978322567 4:107514636-107514658 CTGCTTTTCTGGAGGTCTCAGGG - Intergenic
981715674 4:147749614-147749636 CAACTTTTCTAGATGCTTAAAGG - Intronic
982272432 4:153604949-153604971 CAGCACTTCTGGAGGCCAAAGGG - Intronic
982498542 4:156124069-156124091 CTGCTTTTCTAGTTTCCTAAGGG - Intergenic
983295211 4:165858470-165858492 CAGCTTTTGCAGAAGCCTCATGG - Intergenic
983642612 4:169957116-169957138 CAGCTTCTCTAGAGGCTAAGGGG - Intergenic
984282690 4:177690827-177690849 CAACTTTTCTAGCTGCCTAAAGG + Intergenic
985033819 4:185818892-185818914 CAACTTTCCTATAGGCATAAAGG + Intronic
985350233 4:189053503-189053525 CCCCTTTTCTAGAGGGATAATGG - Intergenic
987325169 5:16805906-16805928 AAGGTTTTCAAAAGGCCTAAGGG + Intronic
990977417 5:61571895-61571917 CATCTTGTCTAGAGGCAGAAAGG - Intergenic
991333529 5:65520288-65520310 CAGCTTCTAGGGAGGCCTAAGGG - Intronic
999033092 5:148316320-148316342 CAGCTCTTCTAGAGTGCTGATGG + Intergenic
999067912 5:148711352-148711374 CAGCTTCTGTAGAGGCCCTAAGG + Intergenic
999571939 5:152928678-152928700 CAACTTTTGCAGAGGCCTATGGG - Intergenic
1000404114 5:160868143-160868165 CAGCTTCTCTAGATGCAGAAAGG - Intergenic
1000887515 5:166763930-166763952 CAGCATTTTCAGAGGCCGAAGGG - Intergenic
1004603312 6:17171434-17171456 CAGCTTCTGGAGAGGCCTCAGGG + Intergenic
1004633314 6:17442637-17442659 CAGCATTTTTAGAGGCCAAGTGG + Intronic
1007849726 6:44791625-44791647 CAGCTTTCCTAGTGGCCCAAGGG + Intergenic
1011011855 6:82711986-82712008 CAGCTTTTCCTGAGGCCCATAGG - Intergenic
1012864264 6:104598621-104598643 AAGCTTTTCTATAGGACCAATGG - Intergenic
1014884864 6:126767455-126767477 CAGGTTTTCTAGTGACCTATAGG + Intergenic
1015121547 6:129706564-129706586 CAGCTTTTCAAAAGACCAAATGG + Intronic
1018404852 6:163468969-163468991 CAGCTGTACTAGAGTCCTGATGG + Intronic
1021042181 7:15875916-15875938 CATCTTTTCTGGAGGACTATTGG + Intergenic
1024145857 7:46515645-46515667 CAGCTTCTGGAGAGGCCTCAGGG - Intergenic
1025610948 7:63075220-63075242 CAGCTTCTGGAGAGGCCTCAGGG + Intergenic
1025708453 7:63887663-63887685 CAGCTTCTGGAGAGGCCTCAGGG - Intergenic
1026848256 7:73709469-73709491 CAGCTGTCCTAGGGGCCTAGGGG - Intronic
1033311470 7:140264951-140264973 CTGCTTGTCTAGGGGCCTAATGG + Intergenic
1033823066 7:145156928-145156950 CAATTTTTCCAGAGACCTAAGGG - Intergenic
1034253756 7:149713676-149713698 CAACTTTTCAAGAGCCCTACAGG - Intergenic
1037751671 8:21686435-21686457 CAGCTTCTCTCAATGCCTAAAGG + Intergenic
1041043850 8:53873201-53873223 CAGCTTTTGGAGAGGTCTAAGGG - Intronic
1041667991 8:60464706-60464728 CAGCTTTGTTCTAGGCCTAAAGG + Intergenic
1042837540 8:73092088-73092110 CAGCTTTTATTGAGCCCTTACGG + Intronic
1043047220 8:75341830-75341852 CAGCTTTTATAGAAGAGTAAAGG + Intergenic
1043765135 8:84121541-84121563 CAGCTTCTCAGGAGGCCTGAGGG + Intergenic
1045200770 8:99978518-99978540 GAGCTTTTCCAGAGGCAAAATGG - Intronic
1047962640 8:130022049-130022071 CAGCTTTTCTTGAGGATTTAAGG - Intergenic
1050120226 9:2300189-2300211 CAATGTTTCTGGAGGCCTAAAGG - Intergenic
1050607357 9:7315396-7315418 CAGGTAGTCTAGAGGCCCAAGGG - Intergenic
1051519499 9:17969794-17969816 CCGCTTTTTTACTGGCCTAATGG - Intergenic
1052859908 9:33431229-33431251 CAGCTTGTCTAAAAGCCTGAAGG - Intergenic
1055690003 9:78819777-78819799 CAGCATTTATAGATGCCTCAGGG + Intergenic
1056185803 9:84133866-84133888 CAACCTTTCTAGAGGCCAACTGG - Intergenic
1060818852 9:126650308-126650330 CATCTTTTCTAGGGGCCAGAGGG + Intronic
1062145748 9:134988766-134988788 CAGCTTCTGGAGAGGCCTCAGGG + Intergenic
1062156715 9:135053211-135053233 CAGCTTGTCCAGAGGGCTCATGG + Intergenic
1188199178 X:27278444-27278466 CAGAATTTCTAAGGGCCTAAGGG + Intergenic
1191210945 X:57884491-57884513 CAGCTTCTTAAGAGGCCTCAGGG + Intergenic
1193139318 X:78009707-78009729 CAGCATTTTGAGAGGCCTAGAGG + Intronic
1193277983 X:79612818-79612840 CAGCTTTTGAGGAGGCCTCAAGG - Intergenic
1193282356 X:79668512-79668534 CAGCTTCTGGAGAGGCCTCAGGG + Intergenic
1194345368 X:92756792-92756814 CAGCTTTTGGGGAGGCCTCAGGG - Intergenic
1197990117 X:132308774-132308796 CAGCTTTTGATGAGGCCTAAGGG - Intergenic
1199280908 X:145998098-145998120 CAGCTTTTCTAGACCACTAAGGG - Intergenic
1200653711 Y:5873442-5873464 CAGCTTTTGGGGAGGCCTCAGGG - Intergenic
1201926619 Y:19294519-19294541 CAGCTGTTTTACAGCCCTAAAGG - Intergenic