ID: 921330457

View in Genome Browser
Species Human (GRCh38)
Location 1:214030534-214030556
Sequence TTTTTAAAGGGGATTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921330446_921330457 26 Left 921330446 1:214030485-214030507 CCATTTCAGTGAAGATCATTTCA 0: 1
1: 1
2: 4
3: 30
4: 289
Right 921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG 0: 1
1: 0
2: 4
3: 47
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921330457 Original CRISPR TTTTTAAAGGGGATTGAGGA GGG Intronic
901161387 1:7178766-7178788 TTTATAAAGGAGGCTGAGGAGGG - Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902320594 1:15661743-15661765 TGTTTAAAGGGAATGGAGAACGG - Exonic
902613187 1:17609077-17609099 TTTTAAAAGGAGCTTGAGGCTGG - Intronic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
905527765 1:38652122-38652144 TTTTTCAAGGGTAGTGAGTAGGG + Intergenic
906445846 1:45897490-45897512 TTTTTAAAGGTGATTTGGGGAGG + Intronic
907243672 1:53094070-53094092 TTTGCAAAGGGGATCGGGGATGG - Intronic
908143819 1:61216701-61216723 TCTAAAAAGGGGATTGAGGCTGG + Intronic
908278484 1:62502766-62502788 TTTTTAAAGGGGAGGCAAGAGGG + Intronic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
910449331 1:87330264-87330286 TTTTAAAAGGAGAGTGAGGGAGG - Intronic
910859539 1:91730424-91730446 GATAGAAAGGGGATTGAGGAAGG - Intronic
913425419 1:118723695-118723717 TTTTTAAAAAGAATTGAAGAGGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914320158 1:146551454-146551476 TTTTTAATGGGTATTGTGAATGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914743560 1:150484940-150484962 TTTTTAAATGGCATTCAGAAAGG - Intergenic
915389416 1:155527913-155527935 TATTTAAAGGTCATGGAGGAAGG - Intronic
915437160 1:155916098-155916120 TTTATAAAGGGGCTGGGGGAAGG - Intronic
915514276 1:156403714-156403736 TTATTAAAAGGGATTCAGGCCGG - Intergenic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
915713502 1:157923212-157923234 TTTTTAAAGTGGCTGGGGGAGGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917150564 1:171939603-171939625 TTTCTAAATGGGAATGAGGAAGG - Intronic
918371750 1:183868048-183868070 TTTTTAGAAGGGCTTGGGGAAGG + Intronic
918543361 1:185655375-185655397 TTTTTAAAGTGGATTGACATGGG + Intergenic
918892883 1:190298390-190298412 TTTTTAAAGATCTTTGAGGAGGG + Intronic
918924309 1:190761364-190761386 TTTTTAAAAGGTTTTAAGGAAGG + Intergenic
919468312 1:197948748-197948770 TTTTAAAAGGGGAGTTGGGAAGG - Intergenic
921128815 1:212201503-212201525 TTTTTAAAAGGGTTTGAGTAGGG + Intergenic
921187100 1:212679488-212679510 TATTTAAAGAGGATAAAGGAGGG + Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921334826 1:214075752-214075774 ATTTTATCAGGGATTGAGGAAGG + Intergenic
921410340 1:214829732-214829754 CTTATAAAAGAGATTGAGGAGGG - Intergenic
923275968 1:232396643-232396665 TTTAAAAAGGGGAGTGATGATGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924580345 1:245317918-245317940 TTTTTCAAGGCCATTGAAGACGG - Intronic
1063460140 10:6210201-6210223 TTTTTAAAAGGGGCTGAGGTTGG + Intronic
1065030286 10:21579101-21579123 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1066033843 10:31459462-31459484 TTTATGGAGTGGATTGAGGAAGG + Intronic
1066436850 10:35403593-35403615 TTATTAAAGAGGATTAATGATGG + Intronic
1066748315 10:38625604-38625626 GTTTAAATGGGGATTAAGGATGG + Intergenic
1066968367 10:42292171-42292193 GTTTAAATGGGGATTAAGGATGG - Intergenic
1068059638 10:52051191-52051213 TTTTAAAAGGAGATGGATGAGGG + Intronic
1069714451 10:70511729-70511751 ATTTTAAAAGGCATTGAGGGCGG + Intronic
1069817218 10:71205888-71205910 TTTTTAAAAGGGATGGACAAAGG + Intergenic
1071245873 10:83762063-83762085 TTTATAAAGTGAATTGAGGCGGG - Intergenic
1072073207 10:91941004-91941026 TTATTAAAGGGAGTTGAGGCCGG - Intronic
1072308020 10:94126794-94126816 TTTTCAAAAGGAATTGAGAATGG + Intronic
1073128993 10:101173526-101173548 TTTTAAAAGGGGATACAGAAAGG - Intergenic
1073138933 10:101235215-101235237 TTTTTAAATAGGATTAAGGCCGG + Intergenic
1073550038 10:104390948-104390970 TTTTTACAGGTGCTTAAGGAGGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075453769 10:122571410-122571432 TTTTTAAAGGCTTTGGAGGATGG + Intronic
1075656287 10:124163311-124163333 TGTTTAATGGGGATGGAGGGAGG + Intergenic
1075830932 10:125410209-125410231 TATTTGAAGGGGATTGAAGAGGG - Intergenic
1075914116 10:126151600-126151622 TTTTTAAAGGAGGGTGTGGAAGG - Intronic
1076088128 10:127653785-127653807 GTTTGAAATGGGAATGAGGATGG - Intergenic
1077067829 11:651638-651660 CTTTGAAAGGAGACTGAGGAGGG + Intronic
1077674864 11:4187129-4187151 TCTTTAAAAGGGAATGGGGAGGG - Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1080250670 11:30229534-30229556 TTTCCAAAGGAGACTGAGGAGGG - Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081415538 11:42810806-42810828 TTTTTGGAGGTGAGTGAGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1086370317 11:86150096-86150118 TTTTAAAAGGGGACTGAAAATGG - Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086889124 11:92236073-92236095 TTTTTAAATAGAATTGAGAAAGG - Intergenic
1086898977 11:92344923-92344945 TTTTTAGAGGTGACTCAGGATGG + Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1088619695 11:111669571-111669593 TTTTTAAAAGAGATGGAGGCGGG - Intronic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1090107462 11:123868309-123868331 TTTTTAAAGTGCACTGCGGATGG + Intergenic
1091085992 11:132722324-132722346 TTTTTAGAGGGGATGCAGGCTGG + Intronic
1091446921 12:549096-549118 TTTTCAACGGGGCCTGAGGATGG - Intronic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092955178 12:13542943-13542965 TTTTTAAAAAGGAGGGAGGATGG - Exonic
1093991172 12:25591422-25591444 TTTGGAAAGGGGATGGAAGAGGG + Intronic
1095181966 12:39156680-39156702 TTTTTAAAAAGGGTTGAGGGGGG + Intergenic
1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG + Intronic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1096310970 12:50520330-50520352 TTTTAAAAGGAGATTCAGGCCGG - Intronic
1096858137 12:54500418-54500440 TTCTTAAAGAGGGTTGAGGCCGG - Intronic
1097381492 12:58900451-58900473 ATTTTAAAGGGATTTTAGGAAGG + Intronic
1097933201 12:65213792-65213814 TTTTGAAAGGGGAGTGAGGAAGG + Intronic
1098056071 12:66506824-66506846 TATGTAAAAGGGAATGAGGAAGG + Intronic
1098386957 12:69929820-69929842 TTTTAAAATGGGATTGATAAAGG + Intronic
1098577409 12:72058909-72058931 TTTTTTAATAGGATTGAGAATGG - Intronic
1099233697 12:80056941-80056963 AAATTAAAGAGGATTGAGGAGGG - Intergenic
1099347509 12:81520947-81520969 TTTTTTAGGGGGGGTGAGGAAGG + Intronic
1099506041 12:83477245-83477267 TTTTTAAAGCTGATCAAGGAAGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1100160527 12:91855263-91855285 CTTTTATAGAGGATTGAGGGAGG - Intergenic
1100293376 12:93237781-93237803 TCTTTCAAGAGGATTGAGCAAGG + Intergenic
1100340596 12:93676061-93676083 TTTTTAGAAGGTTTTGAGGAGGG + Intergenic
1101856535 12:108448174-108448196 TTTTTAAAGGAGAAAGAGCAAGG - Intergenic
1103536663 12:121638192-121638214 TTTTTTATGGGTGTTGAGGAGGG + Intronic
1104321870 12:127759232-127759254 TTTTGAAAGAGGATTGAGATTGG + Intergenic
1104751353 12:131241730-131241752 TATTTAAAGAGGATTTAGGATGG - Intergenic
1106154205 13:27137334-27137356 TTTATAAAGCGGATTGAAGATGG - Intronic
1106500998 13:30328538-30328560 TTTTTAAACGTGTTTGAGGAGGG - Intergenic
1107311795 13:39086381-39086403 TTTATAAAGGGGAGTGGGGGTGG + Intergenic
1107880725 13:44829839-44829861 CTATTACAGGGGATTGATGAGGG - Intergenic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1109038594 13:57300171-57300193 TTTTTAACAGGGGTTGGGGAAGG - Intergenic
1109314525 13:60734550-60734572 TTTAGAAAAGCGATTGAGGAGGG + Intergenic
1110739442 13:78977286-78977308 TTTTTAAGGGGGACTTAGTAGGG + Intergenic
1111579979 13:90210017-90210039 TGATTAAAGGGAATTGAGGCTGG - Intergenic
1112590081 13:100754911-100754933 GTTTTAAATGGGATTGATGAAGG - Intergenic
1112719472 13:102226863-102226885 TTTGAAAAGGGGGTAGAGGAAGG - Intronic
1112870646 13:103966546-103966568 TTTGTAAAAGGAATTGAGTATGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1117031400 14:51674702-51674724 TTTTTAAAGGGTGTGGGGGAAGG - Intronic
1117514080 14:56482944-56482966 TTTTAAAAGGGGAGAGAGGGAGG - Intergenic
1117929319 14:60823311-60823333 TTTTGAGTGGGGATTGGGGAGGG + Intronic
1118355422 14:65009612-65009634 TCTGTAAAGAGGATGGAGGAGGG - Intronic
1118480598 14:66161326-66161348 TTTTGAAAGATTATTGAGGAAGG - Intergenic
1119125119 14:72118141-72118163 TTTTTAAATGGCAGTGAGGGTGG - Intronic
1119326524 14:73762792-73762814 TTTGTAAAGAGGGTTGAGGGTGG - Intronic
1119988595 14:79169099-79169121 TTTTCAAGGGTGACTGAGGATGG - Intronic
1121059685 14:90895208-90895230 TTTTAAAAGGGTAATGAGGCTGG + Intronic
1121697453 14:95925356-95925378 TTTTTACAGGGGAGGGAGAAGGG - Intergenic
1121894690 14:97636026-97636048 TTTTTAAAAAGGAATGAGAAAGG - Intergenic
1124593968 15:31078481-31078503 TTTTTGAAGGCTACTGAGGAAGG - Intronic
1125466288 15:39956298-39956320 GTTATAAAGGGGAATGAGGCTGG - Intronic
1125922007 15:43530513-43530535 TATTGAATGGGGACTGAGGATGG + Exonic
1126427164 15:48540820-48540842 TTTTTAAAAAGGATTGAATATGG - Intronic
1127213885 15:56803799-56803821 ATTTTTAAGGAGATTGAGAAAGG - Intronic
1127464999 15:59235255-59235277 TTTCTAAAGGGTATACAGGAAGG + Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128271565 15:66314803-66314825 TTTTGAAAGATGATTGAGGGTGG + Intronic
1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG + Intergenic
1130409181 15:83630629-83630651 TTTTTAAAGGGGTTTTATAAGGG - Intergenic
1130783804 15:87073470-87073492 TTTTTAAAGGGAAAGGAGCATGG - Intergenic
1131985282 15:98037376-98037398 TTTTTAAAGTGGATGATGGAAGG - Intergenic
1132099251 15:99011738-99011760 TATTTGAAGGGCATTGTGGATGG - Intergenic
1133468302 16:6049308-6049330 TTTTTAAAGGAGACTGAGGTGGG - Intronic
1133518443 16:6532523-6532545 TATTTAAAGGGTACAGAGGAAGG - Intronic
1134863441 16:17582740-17582762 TTATTAAAGTAGAATGAGGATGG + Intergenic
1136108451 16:28048915-28048937 TTTTTAAAAAAGATGGAGGAGGG + Intronic
1136134208 16:28244924-28244946 CCTGTAAAGGGGATGGAGGAAGG - Intergenic
1136734448 16:32451697-32451719 GTTTAAATGGGGATTAAGGATGG - Intergenic
1137281363 16:46979529-46979551 TTATTTAAGGTGTTTGAGGAAGG + Intergenic
1137498888 16:48995354-48995376 TTAATAAAGAGGAATGAGGAGGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138799227 16:60005944-60005966 CTTTTATATGGGATTGGGGAAGG + Intergenic
1138894109 16:61182266-61182288 TTTTTACAGGTAATTGATGAGGG + Intergenic
1139260159 16:65584207-65584229 CTTATAAAGGGGCTTGAGGGAGG - Intergenic
1139552487 16:67682515-67682537 TTCTTAAAGGGGAGAGGGGAAGG - Intronic
1139744550 16:69063688-69063710 TTTTTAATGAGTAGTGAGGATGG + Intronic
1140013367 16:71158619-71158641 TTTTTAATGGGTATTGTGAATGG + Intronic
1140348014 16:74233754-74233776 CTTATAAAGGGGTTTGATGAAGG + Intergenic
1141726364 16:85791797-85791819 TTTGTAAAGGGGAGGCAGGAAGG - Intronic
1203018632 16_KI270728v1_random:377905-377927 GTTTAAATGGGGATTAAGGATGG + Intergenic
1203036967 16_KI270728v1_random:651063-651085 GTTTAAATGGGGATTAAGGATGG + Intergenic
1143305123 17:5940488-5940510 TTGTCAAAGGGGAGAGAGGATGG + Intronic
1143416289 17:6753275-6753297 TTTTTAAATGGGATTGGGGTTGG + Intergenic
1143595435 17:7911144-7911166 TTAATAAAGGGGACTGAAGAGGG - Intronic
1143887697 17:10077305-10077327 TTGTTAATGGGGTTTTAGGAGGG - Intronic
1146025908 17:29320526-29320548 TTTTCACAAGGGATTCAGGAAGG - Intergenic
1146116466 17:30144864-30144886 TATTTAAAGGGGAATGAGAGGGG - Intronic
1146876671 17:36418938-36418960 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1147062713 17:37893923-37893945 TTTTTGAAGGGCATTGTGGTTGG - Intergenic
1147203679 17:38821604-38821626 TGTTTGAAGGGAATTCAGGAAGG - Intronic
1147999914 17:44381618-44381640 TTTTAAAAGGGGCTTGGGCACGG - Intronic
1149732352 17:58958877-58958899 ATTTTAAAAGGGATTGGGGCTGG - Intronic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1150598810 17:66631855-66631877 TGTTTAAAGTTGATTGATGATGG + Intronic
1151155792 17:72122370-72122392 TTTTCAAAGGGGGTTGGGGTTGG + Intronic
1151272310 17:73006427-73006449 TTTTTAAAGGGTCTTGGAGAAGG + Intronic
1152626388 17:81389628-81389650 TTATTAGAGGGGATCAAGGAAGG - Intergenic
1155022548 18:21909976-21909998 ATTTTAAAGTGAATGGAGGAGGG - Intergenic
1155663034 18:28274762-28274784 TTTTTAAAGCAGAGTGGGGAAGG - Intergenic
1156852829 18:41747885-41747907 TTTTTAAAGTACATTAAGGATGG - Intergenic
1157638707 18:49189309-49189331 TTTTTAAAAGGGGTTGAGGTGGG + Intronic
1157992137 18:52510102-52510124 TTTTTGAAGGGGATGCAGGGGGG - Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1158783370 18:60678831-60678853 TTTTTATAAGGTTTTGAGGATGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1161462259 19:4404949-4404971 TTTTTAAAGAGAATTCATGAAGG - Intronic
1161884303 19:6981880-6981902 TTCTTAGAGGGGAATTAGGATGG - Intergenic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1163050835 19:14682515-14682537 TTTTTTAGGGGGATAGAGGTTGG + Intronic
1164122106 19:22275330-22275352 TTTTAAAAGAGGCTTGAAGAGGG + Intergenic
1164178300 19:22797320-22797342 TTTTTAGAAAGGCTTGAGGAGGG - Intergenic
1164961724 19:32437127-32437149 GTTTTAAATGGCACTGAGGAGGG + Intronic
924985828 2:268734-268756 TTTTTAAAGGCATTTGAAGATGG + Intronic
925600443 2:5603625-5603647 TTTTTAAAGGGGCCTGAACAAGG - Intergenic
925665286 2:6247743-6247765 TTTTTAAAAGGTATTTAAGAAGG + Intergenic
926856064 2:17257188-17257210 TTTTTAAAGGAGAGAGGGGAAGG + Intergenic
929161602 2:38837851-38837873 TTATTAGAGTGGATTGTGGATGG - Exonic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930788858 2:55302283-55302305 CTTTTAAAGGGGGTGGAGGTGGG - Intronic
931718894 2:65052904-65052926 TTTTAAAAGATGACTGAGGATGG + Intergenic
932043425 2:68323062-68323084 TTGTAAAAGGGGCTTGAGGGAGG + Intergenic
934311284 2:91867752-91867774 GTTTAAATGGGGATTAAGGATGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
934962113 2:98685322-98685344 TTTTTAAATATGAATGAGGAAGG + Intronic
935882542 2:107580069-107580091 TTTAGAAAGGTGATTTAGGAGGG + Intergenic
936666389 2:114601476-114601498 TGTTTTAAAGGGATTGGGGAGGG + Intronic
938956912 2:136307405-136307427 TTTTTATTGGGGATTCATGATGG + Intergenic
939196897 2:138984466-138984488 TTTTTCCAGGAGATAGAGGAGGG - Intergenic
939216849 2:139249675-139249697 TTTTTAAAGGGTATTCAGATAGG - Intergenic
939308169 2:140435416-140435438 TTTTTAAAAGGAATTGAGTCAGG - Intronic
939531831 2:143372968-143372990 TTTTTTAAGAGGAGAGAGGATGG - Intronic
939566633 2:143793300-143793322 TTTTAAAAGAAGATTGAGGGCGG - Intergenic
941105192 2:161344042-161344064 TATTTAAAGTGTATGGAGGATGG + Intronic
941389116 2:164889895-164889917 TTTTGAAAGGGGCTTAAGAAAGG - Intergenic
941943072 2:171064224-171064246 TTATTAAAGGGGAAGGAGAAGGG + Intronic
942631812 2:177958185-177958207 TTTTTAAAATGCATTGAGGCCGG - Intronic
943294297 2:186117376-186117398 TTTTTAAGGGGATTTGTGGAGGG - Intergenic
943419352 2:187651080-187651102 TTTTAAAAGTGGTTTGAGGCTGG + Intergenic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944191615 2:197009973-197009995 TTTTTAAAGGGGTTGGAGGCAGG - Intronic
945568398 2:211433283-211433305 TTTAAAAAGGGGAGTGAGGCCGG + Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946579030 2:221106593-221106615 TTTTTAAAGGGAGTTGAAGTTGG + Intergenic
947781780 2:232772800-232772822 CTTTTAATGGGGCTTGAGAAGGG + Intronic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948417678 2:237825812-237825834 TTTTTACACTGGAGTGAGGAGGG - Intronic
948578020 2:238966519-238966541 CTTTTAAAGGGGATGGCAGAGGG + Intergenic
1169105117 20:2987923-2987945 TTTTTAAAGGCGATTTAGAAAGG + Intronic
1169725485 20:8724464-8724486 TTTATAAAAGGGAGGGAGGAAGG - Intronic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170730893 20:18973897-18973919 TATTTATAGGTGCTTGAGGAAGG + Intergenic
1171022467 20:21598361-21598383 ATTTTAGAAGGGTTTGAGGAAGG + Intergenic
1172080430 20:32336451-32336473 ACTTTAATGGGGATGGAGGATGG + Intergenic
1172411104 20:34723697-34723719 TTTTTAAGGGGTGTTGGGGATGG - Intronic
1173064936 20:39701519-39701541 TTTTTAAAGGGTCTTTAGGTTGG + Intergenic
1174094606 20:48078316-48078338 TTGTTAAAGGTGTTTGGGGAAGG + Intergenic
1174599797 20:51715033-51715055 CTTTAAAAGGGGATAGGGGAAGG - Intronic
1174855717 20:54043354-54043376 TTTTTAGAGGGATTTGAGGTAGG + Intronic
1174980475 20:55388719-55388741 TTTATAAAGGAGAATCAGGACGG - Intergenic
1175659590 20:60801248-60801270 TTTTTTATGGGAATTCAGGAGGG - Intergenic
1176016395 20:62935929-62935951 TTTCTAGAGAGGATTAAGGAGGG + Intronic
1176216669 20:63951363-63951385 TTTTTCCAGGGGATCCAGGAGGG - Intronic
1177295479 21:19168583-19168605 TTTTTAAAACAGATTGAAGATGG + Intergenic
1177508545 21:22051255-22051277 TTTTTGAAGTTGATTGAAGATGG + Intergenic
1180538044 22:16413663-16413685 GTTTAAATGGGGATTAAGGATGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1181871874 22:25905847-25905869 TCTTTAAAGGGCATGGATGACGG + Intronic
1183003492 22:34880758-34880780 TTTGTAAAGGAGATTTTGGAGGG + Intergenic
1183266668 22:36830960-36830982 TTTAAAAAGTGGATTGGGGAAGG - Intergenic
1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG + Intergenic
1183698742 22:39437998-39438020 GTTTTAAGGGGGTTTGAGAAGGG - Intergenic
949314308 3:2734559-2734581 TTATTACTGGGGACTGAGGACGG - Intronic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949606605 3:5660410-5660432 TTTTTAAGTGGGGTTCAGGAAGG + Intergenic
950766604 3:15277720-15277742 TTTAGAAAGGGGAGTGGGGAAGG - Intronic
950920331 3:16687688-16687710 TTTTTAAAGGGTCTGTAGGAGGG - Intergenic
951402976 3:22257684-22257706 TATTTAAAAGGCATTGTGGAGGG - Intronic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952647960 3:35684960-35684982 TTTTTAATGGAGATTGAAAAGGG + Intronic
953304858 3:41819120-41819142 TTTTAAAGGGGGAGTGCGGAGGG + Intronic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
953361414 3:42300611-42300633 TTTATAAAGGAGCTTGATGATGG - Intergenic
955525270 3:59813517-59813539 TTTTGAGAGGGGATAGAGCAAGG + Intronic
955973874 3:64462490-64462512 TTTTTGGCGGTGATTGAGGAAGG - Intergenic
956538688 3:70309066-70309088 TTTTTAAGGGGGAGTGAGGGAGG + Intergenic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957911187 3:86621667-86621689 TTTTTACAGGGGAGTGCTGAGGG - Intergenic
957999362 3:87731909-87731931 TTTTGAAATGGAAATGAGGAGGG + Intergenic
959207592 3:103330484-103330506 TGTTTAAATGGGAATAAGGATGG - Intergenic
959961045 3:112298374-112298396 GTTTACTAGGGGATTGAGGATGG - Intergenic
960192230 3:114720570-114720592 TTTTTGGAGAGGATTAAGGAGGG + Intronic
962039204 3:131687234-131687256 TTTTTAAAAGGGATGGAGATAGG - Intronic
962326394 3:134436876-134436898 TTTTTTAATGGTATTGAGAATGG + Intergenic
963261568 3:143197081-143197103 TTTATAAAAGGGCTTGAGGGAGG + Intergenic
964151365 3:153528548-153528570 TTTTTAAGGGAGAATTAGGAAGG - Intergenic
964388285 3:156172592-156172614 TTTAAAAAAGGGAATGAGGATGG + Intronic
964932093 3:162038336-162038358 TTTTTAAAGTGGATTGTGTTAGG + Intergenic
965396100 3:168161799-168161821 TTTTTAAAGGTTATTGCGGCTGG + Intergenic
965754923 3:172015945-172015967 TTTTGAAAGGGGGTTGTGGATGG + Intergenic
967003157 3:185356385-185356407 TTTTTTAAAGGGAGTAAGGAGGG + Intronic
967094136 3:186162841-186162863 TTTTTAAAAAGGATTGAGGTTGG - Intronic
967465490 3:189800853-189800875 TTTATAGAGGGGATGGAAGATGG + Intronic
967514924 3:190356551-190356573 GTTTTAAATCAGATTGAGGAAGG - Intronic
970636387 4:18014117-18014139 ATTTTAAAGGCGACTGAGGATGG + Intronic
970955205 4:21802919-21802941 TTTTTAAAGGGGCTTTAAAATGG + Intronic
971004913 4:22362516-22362538 TTTTTGAAAGGGAGGGAGGAGGG - Intronic
971272332 4:25161566-25161588 TTTTTAAGGGGATTTGTGGAGGG - Intronic
972291987 4:37698019-37698041 TCTTTAAAGAGAATAGAGGAAGG - Intergenic
972397668 4:38671843-38671865 TTTTGAAAAGGGATCAAGGAAGG - Intronic
972477229 4:39462004-39462026 TTTCTAAAGTGGTTTGAGCAAGG + Intronic
973783895 4:54317462-54317484 TTTTTAAAGCAAATTGAGGCCGG + Intergenic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974358317 4:60841521-60841543 TTTTAAAAAGAGATTGAGGAAGG + Intergenic
974457811 4:62150341-62150363 TTTTTAAAATGAATTAAGGAAGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
975325086 4:73050147-73050169 TTCTTAATTGGGATTGTGGAGGG + Intergenic
977083541 4:92564524-92564546 TTTTTAAATGAAATTGAAGAAGG + Intronic
977926888 4:102710863-102710885 TTATTGAAGAGGATTGAAGAGGG - Intronic
978124899 4:105123773-105123795 TTTTTAAACAGCATTGAGGGTGG - Intergenic
978738026 4:112106567-112106589 TCTTTAGAGGGGATTTAGGTTGG - Intergenic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
979786004 4:124716137-124716159 TTTTAAAAGGGTATTTAAGAGGG - Intergenic
980175289 4:129337186-129337208 TTTATGAAAGGGATTGAGAAGGG - Intergenic
980232376 4:130061334-130061356 TTTATAAAATGGATTGAGGATGG - Intergenic
981755220 4:148135326-148135348 TTTATAAAAGGGGTTGAGGGGGG + Intronic
982721267 4:158862485-158862507 TATTTAAATGGAATTAAGGAAGG + Intronic
986347993 5:6852402-6852424 TTTTTGGTGGGGGTTGAGGAGGG - Intergenic
986348224 5:6854026-6854048 TTTTTGGTGGGGGTTGAGGAGGG - Intergenic
986692925 5:10328700-10328722 TTGATAAAGGGGTTTGATGATGG - Intergenic
987340895 5:16937660-16937682 TTTCTAAAGGGAAGTGAGGTGGG - Intergenic
987877874 5:23703481-23703503 TTTTTAAAGGTAACTTAGGAAGG + Intergenic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
988535523 5:32064537-32064559 TGTTAAAAGTGGATTGAGGCCGG - Intronic
989242584 5:39217896-39217918 TTTTTAAAGCACATTGAGGCTGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991015179 5:61924728-61924750 TTTTTACATGGGATTAGGGATGG + Intergenic
991056077 5:62322090-62322112 TTTTTAGAGGGGATTGGGGTAGG + Intronic
991926195 5:71707324-71707346 TTTTTAAAGGAGATAGAAAAAGG - Intergenic
992209342 5:74462700-74462722 TTTTTAAAGGGTATTGTTGGTGG - Intergenic
993111054 5:83657688-83657710 TTTTTAAAATGAATTGAGGATGG + Intronic
993433309 5:87859587-87859609 GTCTTAATGGGGAGTGAGGAGGG - Intergenic
993464986 5:88234071-88234093 TTTTTAAGGGGGAGAGAGGTAGG + Intronic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
994268539 5:97747292-97747314 TTTCTAAAGGGTATAAAGGAAGG - Intergenic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
999941769 5:156550832-156550854 TTTTTAAAGGAGATAGTGAAGGG + Intronic
1000240040 5:159400817-159400839 CTATTAAAGGGAATTGAGGCTGG - Intergenic
1000275202 5:159728289-159728311 TTTTTCAAGGAAATTGAGGGGGG + Intergenic
1000632245 5:163604055-163604077 AATATGAAGGGGATTGAGGAGGG + Intergenic
1000881114 5:166698664-166698686 TTTTTAAAGGGCAGGGGGGATGG - Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1002942462 6:1730245-1730267 TTTTGAAAGGGGTCTGCGGAAGG - Intronic
1004460381 6:15829681-15829703 ATGTTGAAGGGGGTTGAGGAAGG + Intergenic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1005273088 6:24187155-24187177 TTTTTTAAGGAAATAGAGGAGGG - Intronic
1005390588 6:25329205-25329227 TTTTTAAAGGTGGGGGAGGATGG - Intronic
1005572084 6:27155383-27155405 TTTCTAAATGGGGTTGGGGAAGG + Intergenic
1006826062 6:36937271-36937293 TTTTTACAGAGGGTTCAGGATGG - Intergenic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1008108461 6:47466337-47466359 TTTTTAAAAGATATTGAGCAAGG + Intergenic
1008715348 6:54282628-54282650 TTTACAAACGGGATAGAGGAAGG + Intergenic
1011213536 6:84980380-84980402 TTTTTAAATGTGATTAATGATGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1013778790 6:113707627-113707649 TTTTTGAGGGGGAATGAAGATGG + Intergenic
1013823063 6:114178768-114178790 TTTTCAAAGGGGAGAGATGAGGG + Intronic
1013989628 6:116238563-116238585 TTTTTAGAAAGGAATGAGGATGG - Intronic
1014623417 6:123697439-123697461 TTTTTAGCAGGTATTGAGGAAGG - Intergenic
1014723416 6:124947278-124947300 TTTTCATAGGGGAATGAGGTAGG + Intergenic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1017626922 6:156358399-156358421 ATTTTAAAGGGGAAAAAGGAGGG + Intergenic
1017854196 6:158334820-158334842 CTTATAAAAGGGCTTGAGGAAGG + Intronic
1018481494 6:164195526-164195548 ATTTGAAAGTGGAGTGAGGATGG - Intergenic
1020768371 7:12354822-12354844 TTTTTAAAAGTTATTTAGGATGG + Intronic
1021865513 7:24952833-24952855 ATTTTAAATGAGATTGGGGAGGG - Intronic
1021894984 7:25224828-25224850 TTTATATAGGGTAGTGAGGAGGG + Exonic
1022762727 7:33374176-33374198 TTTGTAGAGGGTCTTGAGGAAGG + Intronic
1023085759 7:36568676-36568698 TTTCTGAAGGGGATTGAGGAGGG - Intronic
1023191334 7:37586034-37586056 TTTTTAATCTGGATTCAGGATGG - Intergenic
1023231309 7:38033025-38033047 TTTTTAATTGGGTTTGATGATGG + Intergenic
1023338335 7:39193202-39193224 TTTTTAAAGACGATTGCGGGGGG + Intronic
1024502832 7:50131091-50131113 TTTTTACAGGGGAGAGAAGATGG + Intronic
1024940940 7:54762687-54762709 TTTCAAAAAGGGTTTGAGGAGGG - Intergenic
1025997888 7:66539601-66539623 TATTTAAAGGGGAAAGAGGGGGG + Intergenic
1026471606 7:70697913-70697935 TTATTACAGTGGCTTGAGGAAGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027737652 7:81954418-81954440 TTTTTAAAGAGTAATGAGAAAGG - Intronic
1028151417 7:87378045-87378067 TTTATAAAGGGGTTTGGGGCTGG + Intronic
1028464874 7:91139931-91139953 TTTTTCAATGGGATTAAGTAGGG - Intronic
1030001062 7:105063206-105063228 TTTTTTAATGGTATTAAGGAAGG + Intronic
1030913702 7:115285404-115285426 TTTTTGAAGGGGAGAAAGGAAGG + Intergenic
1030933453 7:115554658-115554680 TTTTTAAATATGATTGAAGAAGG + Intergenic
1032637212 7:133722631-133722653 ATTTTAAAGGTCATTGGGGAAGG + Intronic
1032699724 7:134368845-134368867 TTTTTGAAGTGGATCCAGGATGG + Intergenic
1032770648 7:135051601-135051623 TTTTTCCAGGGGATTGAGTTAGG + Intronic
1033708150 7:143908451-143908473 TTCCTAAATGGGATTGAGGTAGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035826885 8:2654205-2654227 GTGTCAAAGGGGATTGAGGGAGG - Intergenic
1035878811 8:3221255-3221277 TTATTAAAGGAAATTTAGGAAGG + Intronic
1037004300 8:13758570-13758592 TTTTTGTAGGGGAGAGAGGATGG + Intergenic
1037213142 8:16416372-16416394 TTTTTAATAGGAAGTGAGGAGGG + Intronic
1037594291 8:20341835-20341857 TTGTTAAACTGGAGTGAGGAGGG - Intergenic
1038113393 8:24525158-24525180 TTTATGAAGAGGATAGAGGATGG - Intronic
1038559215 8:28556172-28556194 TTATTGCAGGGGATTGAGCAGGG + Intronic
1038722791 8:30052576-30052598 TTTTAAAAAGGGCTTGATGAAGG - Intergenic
1038991493 8:32873081-32873103 TTTTTTAAGGGGACTGAAGGGGG + Intergenic
1039476208 8:37840647-37840669 AATTTAAAGGGGAAAGAGGATGG + Intronic
1039787503 8:40846890-40846912 TTTTTATAAGGGATTGGGAAGGG - Intronic
1040418342 8:47216480-47216502 TTTTAAATGTGGATTTAGGAAGG - Intergenic
1043690670 8:83146930-83146952 TTTTTCAAGGGGGTGGAGGATGG - Intergenic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1046253823 8:111669850-111669872 TTTTTCAAAAGGATTTAGGAAGG + Intergenic
1047607782 8:126491777-126491799 TTTGTAGAAGGGATTGGGGAAGG + Intergenic
1047879875 8:129181223-129181245 TGTATAAAGAGAATTGAGGAAGG + Intergenic
1048629445 8:136226038-136226060 TTTCTAAAGTGGATGGAGGGAGG + Intergenic
1048731686 8:137448991-137449013 TTGATAAAGAGGATGGAGGAAGG + Intergenic
1050420082 9:5454289-5454311 TTTTTAAAGGGAAAAAAGGAAGG - Intronic
1051591766 9:18783297-18783319 TTTTAAAAGTAGATTGAAGAGGG + Intronic
1051993885 9:23189850-23189872 TTTTGAAAGGAGAATGAGAAAGG - Intergenic
1052400803 9:27997910-27997932 CTTTTAAATGGGTTTCAGGAAGG + Intronic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1052972972 9:34388745-34388767 GTTTTAGAGGGGTTTTAGGAGGG + Intronic
1053239054 9:36481624-36481646 TTTTTAAACATGATTGAGGGTGG - Intronic
1053422695 9:37989798-37989820 GTTTTAAAGAGGAGTGGGGAAGG + Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054808171 9:69412677-69412699 TTACTAAAGGGAACTGAGGATGG + Intergenic
1055049252 9:71963121-71963143 TTTTTAACTGGGGTTGTGGAAGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1059257093 9:112940673-112940695 GTTTTAATGGGGTTTCAGGAGGG + Intergenic
1059288261 9:113197065-113197087 TTTTTAAAGGGCTGGGAGGATGG - Exonic
1060102299 9:120851301-120851323 TATTTAAAGTGGCTTCAGGAAGG + Intergenic
1060237459 9:121875466-121875488 TTATTAATTGGGATTCAGGAAGG - Intronic
1061316404 9:129798919-129798941 TTATAAAAAGGGCTTGAGGATGG - Intergenic
1185830165 X:3294067-3294089 TCTTTTAAGGGCATTTAGGAAGG - Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186683800 X:11903031-11903053 TTTTTGAAGGAAACTGAGGAAGG + Intergenic
1186693395 X:12003771-12003793 TTTTTAAAGGGGAAAGTGAAAGG - Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1187975711 X:24702747-24702769 TTTTGGAAGGGGATGGATGAGGG + Intronic
1188269233 X:28117999-28118021 TTTTCAAAAGGGATTGATAAAGG - Intergenic
1188437929 X:30184077-30184099 TATGTAAAGGGAATTGAGGGAGG + Intergenic
1189176893 X:38966477-38966499 TCACTAAAGGGGATGGAGGAAGG + Intergenic
1189506881 X:41620195-41620217 TTTTAAAAGGGAATAGTGGAAGG + Intronic
1189718022 X:43884492-43884514 TTTTTAAAAGGGATGGGGGTGGG + Intergenic
1189809260 X:44765617-44765639 ATTTTAAAGGGGCCTCAGGAAGG + Intergenic
1191675644 X:63789587-63789609 TTTTTACAGGGGAAAGATGATGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194329832 X:92568109-92568131 TTTTTGTAGTGTATTGAGGATGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1196898328 X:120359652-120359674 TTTTTGAAGTGCATGGAGGAGGG - Intergenic
1196937394 X:120743362-120743384 TATTTAAAGTGTATTGAGGGTGG - Intergenic
1197171897 X:123443954-123443976 TTTTTACAGAGGTTTTAGGATGG + Intronic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1197419126 X:126216216-126216238 GTTTTAAAGAAAATTGAGGATGG + Intergenic
1198929705 X:141840857-141840879 CTATTCAAGGGGATTGAGAATGG + Intronic
1199270939 X:145881915-145881937 TCTTGAAAGGGGAATGTGGATGG + Intergenic
1199719550 X:150532724-150532746 TTTTCCAAGGGGTTTGAGGATGG - Intergenic
1200638536 Y:5687291-5687313 TTTTTGTAGTGTATTGAGGATGG - Intronic