ID: 921331601

View in Genome Browser
Species Human (GRCh38)
Location 1:214044066-214044088
Sequence CCTTTCTTTAAATGAAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921331601_921331607 22 Left 921331601 1:214044066-214044088 CCAAACCTTCATTTAAAGAAAGG No data
Right 921331607 1:214044111-214044133 CTCAATACTCTCATTGGGTAGGG No data
921331601_921331606 21 Left 921331601 1:214044066-214044088 CCAAACCTTCATTTAAAGAAAGG No data
Right 921331606 1:214044110-214044132 ACTCAATACTCTCATTGGGTAGG No data
921331601_921331605 17 Left 921331601 1:214044066-214044088 CCAAACCTTCATTTAAAGAAAGG No data
Right 921331605 1:214044106-214044128 CACAACTCAATACTCTCATTGGG No data
921331601_921331604 16 Left 921331601 1:214044066-214044088 CCAAACCTTCATTTAAAGAAAGG No data
Right 921331604 1:214044105-214044127 ACACAACTCAATACTCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921331601 Original CRISPR CCTTTCTTTAAATGAAGGTT TGG (reversed) Intergenic
No off target data available for this crispr