ID: 921331607

View in Genome Browser
Species Human (GRCh38)
Location 1:214044111-214044133
Sequence CTCAATACTCTCATTGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921331603_921331607 17 Left 921331603 1:214044071-214044093 CCTTCATTTAAAGAAAGGAGTTC No data
Right 921331607 1:214044111-214044133 CTCAATACTCTCATTGGGTAGGG No data
921331601_921331607 22 Left 921331601 1:214044066-214044088 CCAAACCTTCATTTAAAGAAAGG No data
Right 921331607 1:214044111-214044133 CTCAATACTCTCATTGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921331607 Original CRISPR CTCAATACTCTCATTGGGTA GGG Intergenic
No off target data available for this crispr