ID: 921333162

View in Genome Browser
Species Human (GRCh38)
Location 1:214060743-214060765
Sequence GTCCATATGTTGCTTCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921333162_921333166 2 Left 921333162 1:214060743-214060765 CCATTGAGAAGCAACATATGGAC No data
Right 921333166 1:214060768-214060790 AACGGAGAGGACTAAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921333162 Original CRISPR GTCCATATGTTGCTTCTCAA TGG (reversed) Intergenic
No off target data available for this crispr