ID: 921337278

View in Genome Browser
Species Human (GRCh38)
Location 1:214100854-214100876
Sequence GGAGAAGTAGGTTTGGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921337270_921337278 27 Left 921337270 1:214100804-214100826 CCTGAGCAAGAAGATTGGAGTTT No data
Right 921337278 1:214100854-214100876 GGAGAAGTAGGTTTGGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921337278 Original CRISPR GGAGAAGTAGGTTTGGCGGC TGG Intergenic
No off target data available for this crispr