ID: 921339642

View in Genome Browser
Species Human (GRCh38)
Location 1:214121980-214122002
Sequence TAGTGGGGAAAGCTGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921339635_921339642 20 Left 921339635 1:214121937-214121959 CCATCAGCTGAAGTTAAGTGAGA No data
Right 921339642 1:214121980-214122002 TAGTGGGGAAAGCTGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921339642 Original CRISPR TAGTGGGGAAAGCTGGCTGA AGG Intergenic
No off target data available for this crispr