ID: 921348042

View in Genome Browser
Species Human (GRCh38)
Location 1:214207318-214207340
Sequence AAGAAGCAGAGTTGGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921348038_921348042 -3 Left 921348038 1:214207298-214207320 CCTCATGATGGTATAGTTATAAG No data
Right 921348042 1:214207318-214207340 AAGAAGCAGAGTTGGGGTCCAGG No data
921348034_921348042 21 Left 921348034 1:214207274-214207296 CCTGCCTCTGATTCAGCAAGCTT No data
Right 921348042 1:214207318-214207340 AAGAAGCAGAGTTGGGGTCCAGG No data
921348035_921348042 17 Left 921348035 1:214207278-214207300 CCTCTGATTCAGCAAGCTTCCCT No data
Right 921348042 1:214207318-214207340 AAGAAGCAGAGTTGGGGTCCAGG No data
921348037_921348042 -2 Left 921348037 1:214207297-214207319 CCCTCATGATGGTATAGTTATAA No data
Right 921348042 1:214207318-214207340 AAGAAGCAGAGTTGGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921348042 Original CRISPR AAGAAGCAGAGTTGGGGTCC AGG Intergenic
No off target data available for this crispr