ID: 921348224

View in Genome Browser
Species Human (GRCh38)
Location 1:214208886-214208908
Sequence ACTTGGGTGCCTTTGTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921348221_921348224 2 Left 921348221 1:214208861-214208883 CCGGAGATGAACATTAAGTAGAG No data
Right 921348224 1:214208886-214208908 ACTTGGGTGCCTTTGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921348224 Original CRISPR ACTTGGGTGCCTTTGTCTTT TGG Intergenic
No off target data available for this crispr