ID: 921348525 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:214211857-214211879 |
| Sequence | GACACTGTACATGTCAGCAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921348525_921348532 | 20 | Left | 921348525 | 1:214211857-214211879 | CCACTGCTGACATGTACAGTGTC | No data | ||
| Right | 921348532 | 1:214211900-214211922 | CCATGTAACCTCCACAGCTAAGG | No data | ||||
| 921348525_921348535 | 30 | Left | 921348525 | 1:214211857-214211879 | CCACTGCTGACATGTACAGTGTC | No data | ||
| Right | 921348535 | 1:214211910-214211932 | TCCACAGCTAAGGTGTCCTTGGG | No data | ||||
| 921348525_921348534 | 29 | Left | 921348525 | 1:214211857-214211879 | CCACTGCTGACATGTACAGTGTC | No data | ||
| Right | 921348534 | 1:214211909-214211931 | CTCCACAGCTAAGGTGTCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921348525 | Original CRISPR | GACACTGTACATGTCAGCAG TGG (reversed) | Intergenic | ||