ID: 921348525

View in Genome Browser
Species Human (GRCh38)
Location 1:214211857-214211879
Sequence GACACTGTACATGTCAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921348525_921348532 20 Left 921348525 1:214211857-214211879 CCACTGCTGACATGTACAGTGTC No data
Right 921348532 1:214211900-214211922 CCATGTAACCTCCACAGCTAAGG No data
921348525_921348535 30 Left 921348525 1:214211857-214211879 CCACTGCTGACATGTACAGTGTC No data
Right 921348535 1:214211910-214211932 TCCACAGCTAAGGTGTCCTTGGG No data
921348525_921348534 29 Left 921348525 1:214211857-214211879 CCACTGCTGACATGTACAGTGTC No data
Right 921348534 1:214211909-214211931 CTCCACAGCTAAGGTGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921348525 Original CRISPR GACACTGTACATGTCAGCAG TGG (reversed) Intergenic