ID: 921348534

View in Genome Browser
Species Human (GRCh38)
Location 1:214211909-214211931
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921348525_921348534 29 Left 921348525 1:214211857-214211879 CCACTGCTGACATGTACAGTGTC No data
Right 921348534 1:214211909-214211931 CTCCACAGCTAAGGTGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type