ID: 921349297

View in Genome Browser
Species Human (GRCh38)
Location 1:214219163-214219185
Sequence CTGAACCCTCAGATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921349293_921349297 14 Left 921349293 1:214219126-214219148 CCATATTAACAGGTAGTCATTCT No data
Right 921349297 1:214219163-214219185 CTGAACCCTCAGATGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921349297 Original CRISPR CTGAACCCTCAGATGGAATG AGG Intergenic
No off target data available for this crispr