ID: 921350760

View in Genome Browser
Species Human (GRCh38)
Location 1:214232105-214232127
Sequence CAAAATGAATCTAGCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921350760_921350763 29 Left 921350760 1:214232105-214232127 CCTTGAGAGCTAGATTCATTTTG No data
Right 921350763 1:214232157-214232179 GAGATGTTGGCCCGGCACAGTGG No data
921350760_921350762 21 Left 921350760 1:214232105-214232127 CCTTGAGAGCTAGATTCATTTTG No data
Right 921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG No data
921350760_921350761 16 Left 921350760 1:214232105-214232127 CCTTGAGAGCTAGATTCATTTTG No data
Right 921350761 1:214232144-214232166 ACTGCAAGAAGCAGAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921350760 Original CRISPR CAAAATGAATCTAGCTCTCA AGG (reversed) Intergenic
No off target data available for this crispr