ID: 921350762

View in Genome Browser
Species Human (GRCh38)
Location 1:214232149-214232171
Sequence AAGAAGCAGAGATGTTGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921350760_921350762 21 Left 921350760 1:214232105-214232127 CCTTGAGAGCTAGATTCATTTTG No data
Right 921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921350762 Original CRISPR AAGAAGCAGAGATGTTGGCC CGG Intergenic
No off target data available for this crispr