ID: 921353370

View in Genome Browser
Species Human (GRCh38)
Location 1:214261003-214261025
Sequence AAGGAGAAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921353370_921353376 10 Left 921353370 1:214261003-214261025 CCTTCCTCCTCCTCCTTCTCCTT No data
Right 921353376 1:214261036-214261058 TACGTCATTGACATTTTTAAAGG No data
921353370_921353378 16 Left 921353370 1:214261003-214261025 CCTTCCTCCTCCTCCTTCTCCTT No data
Right 921353378 1:214261042-214261064 ATTGACATTTTTAAAGGGTCTGG No data
921353370_921353377 11 Left 921353370 1:214261003-214261025 CCTTCCTCCTCCTCCTTCTCCTT No data
Right 921353377 1:214261037-214261059 ACGTCATTGACATTTTTAAAGGG No data
921353370_921353379 17 Left 921353370 1:214261003-214261025 CCTTCCTCCTCCTCCTTCTCCTT No data
Right 921353379 1:214261043-214261065 TTGACATTTTTAAAGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921353370 Original CRISPR AAGGAGAAGGAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr