ID: 921355504

View in Genome Browser
Species Human (GRCh38)
Location 1:214281239-214281261
Sequence GCGCCCCGCCGCCACCATGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921355499_921355504 3 Left 921355499 1:214281213-214281235 CCGCAGCTCGGGCACAGCCGGCG 0: 1
1: 0
2: 1
3: 8
4: 98
Right 921355504 1:214281239-214281261 GCGCCCCGCCGCCACCATGAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
921355494_921355504 24 Left 921355494 1:214281192-214281214 CCAATAACAGCTCGCCGGGAGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 921355504 1:214281239-214281261 GCGCCCCGCCGCCACCATGAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
921355497_921355504 10 Left 921355497 1:214281206-214281228 CCGGGAGCCGCAGCTCGGGCACA 0: 1
1: 0
2: 3
3: 14
4: 146
Right 921355504 1:214281239-214281261 GCGCCCCGCCGCCACCATGAGGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921355504 Original CRISPR GCGCCCCGCCGCCACCATGA GGG Exonic
900265109 1:1753389-1753411 GCGACCCGCTGCCCCCAGGACGG + Intronic
900480357 1:2895193-2895215 GGGCCCCTCATCCACCATGAGGG - Intergenic
902515242 1:16986454-16986476 GGGCCCCACCTCCAGCATGAAGG + Exonic
903055502 1:20633533-20633555 GGGCCGCGGCGCCACCATGGCGG + Exonic
904810191 1:33158428-33158450 GGGCCCCGCAGCCACCTTCAGGG + Intronic
905137142 1:35808401-35808423 GGCCCCCGCCGCCGCCATGGAGG + Exonic
910116912 1:83741591-83741613 GCTCCCCTCCCCCACCTTGATGG + Intergenic
915698639 1:157769717-157769739 GCGCCCGGCCGCAACCTGGAGGG + Intronic
915916920 1:159945850-159945872 GCTTCCCGCCGCCAGCAAGAGGG + Intergenic
920100898 1:203516430-203516452 GTGCCCTGCAGCCAGCATGATGG + Intergenic
921355504 1:214281239-214281261 GCGCCCCGCCGCCACCATGAGGG + Exonic
922416493 1:225427647-225427669 GCGCCGCGCCGCCAACATGGAGG + Intronic
922775300 1:228211765-228211787 GGTCCCCGCCGCCACCCTCATGG + Exonic
1062877506 10:954673-954695 GCGCCCGGCCGGTACCCTGAAGG - Intergenic
1064859826 10:19815751-19815773 GCGCCCCGCCCCGACCCTGGCGG - Intergenic
1073216656 10:101840250-101840272 GCACCCCGCCCCCACCATTTTGG + Intronic
1078023602 11:7673994-7674016 GCGCCCCGCCAGCCTCATGATGG - Exonic
1084485114 11:69443608-69443630 GCGCCCCGCCAGCCCCATCACGG + Intergenic
1084518278 11:69648018-69648040 GCTCCCCGCTGCCACCATGGAGG - Exonic
1084804830 11:71571588-71571610 GCGCCCCTCCGTCTGCATGAGGG - Intergenic
1084805625 11:71576935-71576957 GCGCCCCTCCGTCTGCATGAGGG + Intergenic
1091986192 12:4911363-4911385 GCGCCCGGCTTCCACCATGACGG + Exonic
1095206184 12:39442964-39442986 GCTGCCCGCCGCCAGCATGTTGG - Exonic
1122970642 14:105150799-105150821 GCGTCCCGCAGGCACCCTGACGG + Intronic
1124652831 15:31485689-31485711 GCACCCAGCGGCCAGCATGATGG - Intronic
1128139075 15:65286382-65286404 GCGGCCCGCCGCCTCCCTGGCGG + Exonic
1128158749 15:65409328-65409350 GAGCCCCACCTCCACCAGGACGG + Intronic
1131829648 15:96345876-96345898 GCGCGCAGCCGCCAGCTTGATGG + Intergenic
1132694518 16:1195911-1195933 CGGCCCCGCCCCCAGCATGATGG + Exonic
1132799559 16:1745193-1745215 ATTCCCCGCAGCCACCATGAGGG + Intronic
1132931226 16:2460140-2460162 GCAGCCCGCCGGCAGCATGAAGG - Exonic
1141622126 16:85241908-85241930 CCTCCCGGCAGCCACCATGAAGG - Intergenic
1141899498 16:86981698-86981720 GCGCCCCGCCACCAGCCTCACGG - Intergenic
1142174403 16:88638626-88638648 CCCCGCTGCCGCCACCATGACGG + Exonic
1143176393 17:4957633-4957655 GGGTCCTGCCACCACCATGAAGG + Intergenic
1147613862 17:41817081-41817103 GCGCCCCACACCCACCACGATGG - Exonic
1147900237 17:43778918-43778940 GGGCCCCGCCGCCGCCATGTCGG - Exonic
1148769064 17:50056498-50056520 GCCGCCGGCCGCCACCATCAAGG - Exonic
1150572978 17:66404369-66404391 CCCCTCCGCCGCCCCCATGAAGG - Intronic
1152809705 17:82375659-82375681 GCGCCCACCCGCCTCCCTGAGGG + Intergenic
1155507852 18:26549239-26549261 GCGCCTCGCCGCCAGCAAGTAGG - Exonic
1161973339 19:7595998-7596020 GGGCGCCGCCTCCACCATGGCGG - Exonic
1162426906 19:10602515-10602537 CCGCCCCGCCGCGGCCATGGAGG + Intronic
1163843936 19:19628245-19628267 GCGCCCCGCCCCCACCACCTGGG + Intronic
1165089157 19:33373690-33373712 GCGCGCCGCCGCCGCCATCCCGG - Exonic
1166857983 19:45792705-45792727 GGGCCCCGGCGCCGCCATGGGGG - Exonic
1167269347 19:48498843-48498865 GGGCGCCGCCGCCCCCATGAGGG + Exonic
925412073 2:3645563-3645585 TGGCCCCACCTCCACCATGAGGG + Intergenic
925751995 2:7097121-7097143 GGGCCCCCACCCCACCATGAGGG - Intergenic
929188585 2:39120416-39120438 GCGCCCCGGGGGCACCATGCAGG - Exonic
933460529 2:82577982-82578004 GGCGCCCGCCGCCACCATGCAGG - Intergenic
937906477 2:127055179-127055201 CCACCCGGCCTCCACCATGAAGG + Intronic
948823268 2:240560944-240560966 GCGCACCGCGGCCTCCATGGCGG - Exonic
948953762 2:241272239-241272261 CCGCCCCGCCGCCACCTGGGGGG + Intronic
1172056504 20:32158018-32158040 GCCCCCCTCCGCCACCAGAAGGG + Intronic
1173865240 20:46308669-46308691 GCGCCCCTCCTACACCAGGAGGG + Intergenic
1174475893 20:50795299-50795321 GCGCCCCGCAGCCACCCTTCAGG - Intronic
1174774537 20:53331815-53331837 GAGCTCTGCCGCCACCAGGAAGG - Intronic
1182299350 22:29329180-29329202 GTGCCCGGCCCCCACCCTGAGGG + Intronic
1182335556 22:29581123-29581145 GCGCCCCGCCTCCGCCACCAGGG - Exonic
1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG + Intergenic
1185409678 22:50674980-50675002 CCGCCCCGCCGGCCCCATGCGGG - Intergenic
949552450 3:5122450-5122472 GCTCCCGGCCGCCATCATGCTGG + Exonic
950318286 3:12025160-12025182 GAGCCCCTCCCCCCCCATGATGG - Intronic
953956483 3:47235719-47235741 CCGCCCCACCGCCACCAAAAGGG + Intronic
954151750 3:48661380-48661402 GCGCCTCTCGGCCACCACGATGG - Exonic
954781265 3:53063091-53063113 CCGCCCCGCCTCCACCAGGGTGG - Intronic
956678180 3:71754270-71754292 ACGCCGCGCCGCCAGCATGACGG - Exonic
965289722 3:166864613-166864635 ACCCCCGGCAGCCACCATGATGG + Intergenic
968642494 4:1721590-1721612 CCGCGCCGCCGCCGCCAGGAAGG - Exonic
980595072 4:134944256-134944278 GACCCCGGCCGCCGCCATGATGG + Intergenic
981504236 4:145482220-145482242 GCGACCCCCCCCCCCCATGATGG + Intronic
986063754 5:4216011-4216033 GCACCCCACAGCCACCATCATGG - Intergenic
986600136 5:9464876-9464898 GCGGTCTGCAGCCACCATGAAGG + Intronic
996777075 5:127143920-127143942 GCGCACCGCCGTCACCATGCTGG + Intergenic
997714054 5:136029103-136029125 GGGCCCCGCCGCGACCCTGGCGG + Exonic
1019109529 6:169698746-169698768 GCCCTCCGCCTCCAGCATGAAGG - Intronic
1019357887 7:590460-590482 GGGCCCCGCCCCCACCCTGCTGG - Intronic
1019525041 7:1477049-1477071 GCGGCCCTCCAGCACCATGACGG - Intronic
1025032883 7:55572024-55572046 GCACCCCGCCCCCACCCTGCGGG - Intronic
1025032931 7:55572209-55572231 GCCCCCAGCCGCCAGCATGGTGG + Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1036747263 8:11418611-11418633 GAGCCCCTCCTCCACCGTGATGG - Intronic
1048152128 8:131904237-131904259 GAGCGCCGACGGCACCATGACGG - Exonic
1049591302 8:143464179-143464201 GCGCCGCGGCGCCCGCATGATGG - Intronic
1060672784 9:125485031-125485053 GCGCCCCACAGCCTCCATGTGGG + Intronic
1190119731 X:47650296-47650318 ACTCCCCGCCGCCACCACCACGG - Intronic
1197745706 X:129931574-129931596 GCGCCCCCCCGCCCCCAACAGGG + Intergenic
1200229513 X:154437072-154437094 GCGCCCCGCCGCAACCGGCAGGG - Exonic