ID: 921363869

View in Genome Browser
Species Human (GRCh38)
Location 1:214355728-214355750
Sequence ATATTCCCCATTAAGTTCTT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921363869_921363876 28 Left 921363869 1:214355728-214355750 CCGAAGAACTTAATGGGGAATAT 0: 1
1: 0
2: 1
3: 18
4: 204
Right 921363876 1:214355779-214355801 TCACAAAGGCATACTTTTTCTGG 0: 1
1: 0
2: 1
3: 18
4: 174
921363869_921363873 2 Left 921363869 1:214355728-214355750 CCGAAGAACTTAATGGGGAATAT 0: 1
1: 0
2: 1
3: 18
4: 204
Right 921363873 1:214355753-214355775 ACCTGTTGGCATGTGGTGATGGG 0: 1
1: 0
2: 0
3: 10
4: 131
921363869_921363875 14 Left 921363869 1:214355728-214355750 CCGAAGAACTTAATGGGGAATAT 0: 1
1: 0
2: 1
3: 18
4: 204
Right 921363875 1:214355765-214355787 GTGGTGATGGGATGTCACAAAGG 0: 1
1: 0
2: 0
3: 14
4: 192
921363869_921363872 1 Left 921363869 1:214355728-214355750 CCGAAGAACTTAATGGGGAATAT 0: 1
1: 0
2: 1
3: 18
4: 204
Right 921363872 1:214355752-214355774 TACCTGTTGGCATGTGGTGATGG 0: 1
1: 0
2: 0
3: 23
4: 195
921363869_921363871 -5 Left 921363869 1:214355728-214355750 CCGAAGAACTTAATGGGGAATAT 0: 1
1: 0
2: 1
3: 18
4: 204
Right 921363871 1:214355746-214355768 AATATATACCTGTTGGCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921363869 Original CRISPR ATATTCCCCATTAAGTTCTT CGG (reversed) Exonic
901294398 1:8149296-8149318 ATATGCCCCATGAAGATCATCGG + Intergenic
904703379 1:32372491-32372513 ATATTCCACATCTAGCTCTTGGG + Intronic
907208292 1:52794774-52794796 GTATCCCACATTGAGTTCTTTGG + Intronic
908295719 1:62711161-62711183 ATATTTAGCATTAATTTCTTAGG - Intergenic
910529852 1:88223461-88223483 ATATTCCCTATTAAGTATATGGG - Intergenic
911927291 1:103851031-103851053 ATATTACCCTTTAAGTTCTAGGG + Intergenic
911985087 1:104612461-104612483 TTATTACACATTAAGTTCTGGGG - Intergenic
915781623 1:158558356-158558378 ATGGTCGACATTAAGTTCTTTGG + Intergenic
916156136 1:161850577-161850599 ATCTTCCCCATTAAGGTCTTTGG + Intronic
916198611 1:162248819-162248841 ATATACACCATTAAAGTCTTCGG + Intronic
916260568 1:162838150-162838172 TTCTTCCCCAATCAGTTCTTAGG + Intronic
916547674 1:165821730-165821752 ATTTTCCCTAATTAGTTCTTAGG - Intronic
919449596 1:197754854-197754876 ATATTACCCATTATATTCTCTGG + Intronic
921363869 1:214355728-214355750 ATATTCCCCATTAAGTTCTTCGG - Exonic
922391421 1:225147326-225147348 ATTTTCCCCAATAAGTGTTTAGG + Intronic
1064828960 10:19440356-19440378 ATATTACACTTTAAGTTCTAGGG + Intronic
1065559524 10:26948319-26948341 ATCTTCTCCAGCAAGTTCTTCGG + Intergenic
1074141329 10:110675677-110675699 ATAGTCCCCCTCAAGTTCTAAGG + Intronic
1074734730 10:116418151-116418173 ATATTACCTTTTAAATTCTTTGG - Intergenic
1078295820 11:10069175-10069197 ATATTCTACTTTAAGTTCTAGGG + Intronic
1080327346 11:31092014-31092036 ATATTCCCCTTTAATTTCCTTGG - Intronic
1080434989 11:32231685-32231707 ATATTCACCATTATTTTCTTAGG + Intergenic
1080944479 11:36956194-36956216 ATATCCCCTATTATTTTCTTAGG - Intergenic
1083516995 11:63269211-63269233 ATATGCCCCATTAAGTTGACTGG + Intronic
1083566584 11:63723796-63723818 ATATTCTGCCTTAAGTTGTTTGG + Intronic
1084338979 11:68480423-68480445 ATATTATCCATTCTGTTCTTTGG - Intronic
1085004570 11:73074469-73074491 ATATTTCACATTTAGTTCTATGG - Intronic
1086281551 11:85195278-85195300 ATAGTCACCATTAACATCTTTGG - Intronic
1086447652 11:86885233-86885255 ATTTTGCCTATGAAGTTCTTGGG - Intronic
1086770836 11:90764265-90764287 ATATTATGCATTAAGTTTTTAGG - Intergenic
1087573137 11:99956118-99956140 ATATTATTCATTAAGTTCTTAGG + Intronic
1088227387 11:107636193-107636215 ATAATCAGCATTAAGATCTTGGG - Intronic
1088334584 11:108689764-108689786 ACATTCCCTATTAAGTCATTGGG - Intronic
1088337005 11:108716946-108716968 ATATTCCACAGTAGATTCTTCGG + Intronic
1088411980 11:109544287-109544309 AAATTACCCTTTAAGTTCTAGGG - Intergenic
1090027133 11:123177467-123177489 AAATTTACCATTAAGTCCTTGGG - Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090838401 11:130469817-130469839 GTTTTCCCCATCAAGTTCTTGGG - Intronic
1094274174 12:28651617-28651639 CTGTTCTCCATTAAGTTTTTAGG + Intergenic
1095263416 12:40125153-40125175 ATATTCCTCATTACCTTCTATGG + Intergenic
1095717668 12:45365375-45365397 ATTTTTCCTTTTAAGTTCTTTGG + Intronic
1096586771 12:52628025-52628047 AAATTCCCCATGAAGTTTATTGG + Intergenic
1096766794 12:53897690-53897712 ATTGTCCCCAGTAATTTCTTTGG + Intergenic
1098264079 12:68701245-68701267 ATATTTCTCATTATTTTCTTAGG - Intronic
1099782676 12:87218151-87218173 ATATTTTCCATTAGGTTATTTGG - Intergenic
1101028302 12:100635410-100635432 ATGTTCCCTATAAAGTTCCTAGG + Intergenic
1101195801 12:102380931-102380953 ATATTCCCCAAACAATTCTTTGG + Intergenic
1108014973 13:46065284-46065306 AAATTCCCTATTGGGTTCTTGGG + Intronic
1108016807 13:46085368-46085390 ATATGCACCATTTAGCTCTTCGG + Intronic
1108080750 13:46732514-46732536 ACACTCTCCATTAACTTCTTTGG + Intronic
1108082216 13:46748241-46748263 ATATTCACCTTTATGTTATTGGG + Intronic
1108234146 13:48384835-48384857 ATATTGCCCATTAATCTCTCTGG - Intronic
1109002129 13:56818514-56818536 ATATTACACTTTAAGTTCTGGGG - Intergenic
1110293275 13:73832941-73832963 ATTCTCTCCATTAAGTTCATAGG - Intronic
1111573312 13:90116574-90116596 CTATTCCCCATTAAGGTTTAGGG + Intergenic
1111737650 13:92162994-92163016 ATATTCGTCATTACATTCTTGGG + Intronic
1117689790 14:58294929-58294951 ATGGTCCACATTGAGTTCTTCGG + Intronic
1117708272 14:58496444-58496466 ATATTTCTCATTAATTTCTGGGG + Intronic
1119091356 14:71784293-71784315 ATATTCCACAGTAATTTCCTAGG - Intergenic
1119682936 14:76606537-76606559 TTATTCCCCCATAAGTTCTCAGG + Intergenic
1121720970 14:96108473-96108495 CTATCACCCATCAAGTTCTTAGG + Intergenic
1123695911 15:22879166-22879188 AAATGCCCCATTGAGTTCTTCGG - Intronic
1124035895 15:26053452-26053474 ATATTCCCAATGAAGTTTTGAGG + Intergenic
1125203948 15:37129758-37129780 ATATTCCAAATTAAGTCCTCAGG - Intergenic
1126941127 15:53766793-53766815 ATATACCCCACTAAGTTTTGAGG + Intergenic
1127478453 15:59356575-59356597 ATTTTTCCCATTAAGTTTTTTGG + Intronic
1129877511 15:78985469-78985491 ATAGTTCTCATTAAGTTCCTAGG - Intronic
1135949855 16:26903846-26903868 ATTTTACCCTTTAAGTTCTCTGG + Intergenic
1137840226 16:51634148-51634170 AAAATGCCCATTAAGTTTTTTGG + Intergenic
1137872701 16:51966056-51966078 GTATTTCCCTTTAAATTCTTGGG + Intergenic
1139224969 16:65225766-65225788 AAATTCACCATAAAGTTCTTAGG - Intergenic
1140019951 16:71229285-71229307 TTATTCTCCTTTAAGTTCTAGGG - Intronic
1140957983 16:79885029-79885051 ATATGCCCCATGAAGTATTTAGG + Intergenic
1141269039 16:82522365-82522387 ATATTACCCAGTCAGTTCATGGG - Intergenic
1150184969 17:63170687-63170709 AGAATCCCCATTAAATTCTGGGG + Intronic
1152438873 17:80293012-80293034 ATATACTCTATAAAGTTCTTAGG - Intronic
1154008161 18:10552127-10552149 ATATTACCCATTAAAGTCTGGGG + Exonic
1154368186 18:13730818-13730840 ATCTTCCACATTAGGTTCTGTGG + Intronic
1161607280 19:5222193-5222215 ATTTTCACCTTGAAGTTCTTGGG + Exonic
1164124609 19:22301131-22301153 ATATACACCATTAAGTTTTACGG - Intronic
1164835533 19:31352881-31352903 ACTCTTCCCATTAAGTTCTTAGG - Intergenic
1165768683 19:38366097-38366119 ACATTCCTCATTCAGTTCTTTGG + Intronic
1167802710 19:51755501-51755523 ACATTCCCCTTCAAATTCTTAGG + Intronic
925836026 2:7947750-7947772 AAATTGCCCAGTGAGTTCTTGGG + Intergenic
926574984 2:14570279-14570301 GCATTCTCCATTATGTTCTTGGG - Intergenic
926659662 2:15450243-15450265 ATATTCCCAATTAATTTGTTAGG - Intronic
931504610 2:62910782-62910804 ATATTCCCCATCAAAATATTAGG - Intronic
938003723 2:127769834-127769856 ATATTACCTATTAGGTTCATTGG - Intronic
938403195 2:131011330-131011352 ATATTTCCCATAAAATTCCTAGG - Intronic
938885184 2:135639254-135639276 ATATTACCCCTTAAGTGCTCCGG - Intronic
939352154 2:141053061-141053083 ATTTTCCCCATTATTTTCTTTGG + Intronic
940181128 2:150934404-150934426 AAATTTCCCATTGAGTGCTTGGG + Intergenic
940502212 2:154506849-154506871 TTATTCCACATTAAGCTCTGTGG - Intergenic
940951889 2:159684677-159684699 ATATTCCCCTTTACATTATTTGG + Intergenic
942007981 2:171727234-171727256 ATATTCACAAATAAGTTCCTGGG - Intronic
944967993 2:204958008-204958030 ATTTGCCACATTGAGTTCTTTGG - Intronic
945595617 2:211787045-211787067 ATATTTCCCATTATATTATTAGG + Intronic
946530112 2:220561556-220561578 ATATTACACTTTAAGTTCTAGGG - Intergenic
946691001 2:222308168-222308190 ATATTTCCCATTGTCTTCTTTGG + Intergenic
946889730 2:224262731-224262753 ATCATCCCCAATAATTTCTTGGG - Intergenic
947137613 2:226990880-226990902 ATATTCTCTACCAAGTTCTTTGG + Intronic
1172193898 20:33079034-33079056 ATATTCCTCACTCATTTCTTAGG - Intergenic
1173031820 20:39368070-39368092 ATTTTCCCCAGAAAGTTCTTTGG + Intergenic
1174226919 20:49008123-49008145 ATATTTCACATTAACTGCTTTGG - Intronic
1174424903 20:50425110-50425132 ATATTACACATTAAGAGCTTAGG + Intergenic
1177674336 21:24276721-24276743 ATATTCCCCATTAAGAAGTTTGG - Intergenic
1178624946 21:34207190-34207212 AAAATCCCCATCATGTTCTTAGG - Intergenic
1184602186 22:45550167-45550189 ATCTGCCTCATTGAGTTCTTAGG + Intronic
951251885 3:20403380-20403402 ATTATCACCATTAAGTTTTTTGG - Intergenic
955911241 3:63862565-63862587 AAATTCCACATGAAGTTCCTGGG + Intronic
960451549 3:117815373-117815395 ATATTTCACATTAAGTTCCCAGG - Intergenic
960715527 3:120571386-120571408 ATATTATCCATTAAATACTTTGG - Intergenic
960856897 3:122111109-122111131 ATATTCTTCATTACATTCTTAGG - Intronic
962812321 3:138970217-138970239 ATATTACCCATTCAGTACATTGG - Intergenic
963275864 3:143329474-143329496 TGATTTCCCATTGAGTTCTTGGG + Intronic
964877654 3:161386917-161386939 ATATTTCCTACAAAGTTCTTAGG - Intergenic
965365289 3:167791019-167791041 AAATTACCAATGAAGTTCTTTGG - Intronic
965791041 3:172388136-172388158 ATATCTCCCCTTCAGTTCTTGGG + Intronic
966052440 3:175636987-175637009 ATTTTCAACATGAAGTTCTTGGG - Intronic
967581960 3:191169071-191169093 TTATTTCCCATAAAGCTCTTTGG + Intergenic
969763690 4:9211384-9211406 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969764296 4:9216132-9216154 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969764902 4:9220879-9220901 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969765510 4:9225623-9225645 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969766123 4:9230368-9230390 ATTCTCTCCATTGAGTTCTTCGG - Intergenic
969766735 4:9235112-9235134 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969767344 4:9239857-9239879 ATTCTCTCCATTGAGTTCTTCGG - Intronic
969767950 4:9244606-9244628 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969768553 4:9249357-9249379 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969769160 4:9254105-9254127 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969769774 4:9258851-9258873 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969770379 4:9263599-9263621 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969770996 4:9268346-9268368 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969771973 4:9325892-9325914 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969772589 4:9330638-9330660 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969773206 4:9335385-9335407 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969773821 4:9340130-9340152 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969774436 4:9344875-9344897 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969775051 4:9349620-9349642 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969775666 4:9354365-9354387 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969776281 4:9359110-9359132 ATTCTCTCCATTGAGTTCTTCGG - Intronic
969776895 4:9363856-9363878 ATTCTCTCCATTGAGTTCTTCGG - Exonic
969777510 4:9368601-9368623 ATTCTCTCCATTGAGTTCTTCGG - Intergenic
970352074 4:15211531-15211553 TTATTCCCATTTAAGTTATTTGG - Intergenic
970977743 4:22060187-22060209 ATATCCCACCTTTAGTTCTTGGG + Intergenic
971470929 4:27026314-27026336 TTTGTGCCCATTAAGTTCTTGGG + Intergenic
971552179 4:27971155-27971177 CAATTCACCATGAAGTTCTTGGG + Intergenic
971930560 4:33077108-33077130 CCCTTCCCCATTAATTTCTTTGG + Intergenic
973233308 4:47867193-47867215 TTCTTCTCCATTATGTTCTTAGG - Intronic
976465820 4:85367708-85367730 CTGTACCCCATTAAGTTGTTGGG - Intergenic
977754650 4:100653197-100653219 TTTTTCCCCACTAAGTTCTATGG - Intronic
979111879 4:116768820-116768842 ATATTATTCATTAACTTCTTAGG + Intergenic
979991820 4:127383679-127383701 TTATTCCTCATTGAGTTCTCTGG - Intergenic
981431870 4:144670834-144670856 TTAATTCCCATTAAATTCTTAGG + Intronic
981540409 4:145840708-145840730 ATTTTCCCTTTTTAGTTCTTTGG - Intronic
981780258 4:148421209-148421231 ATATTCACCATTAAGTTAAGTGG + Intronic
983087976 4:163470742-163470764 ATTACCCTCATTAAGTTCTTTGG - Intergenic
983148668 4:164248663-164248685 ATATTCTCCATTGTGTTCTAGGG + Intronic
983295284 4:165859136-165859158 ATCTTCCACATGAAGTTTTTTGG - Intergenic
984976467 4:185234889-185234911 TTATTCCCCATTAACTTGCTGGG - Intronic
985040294 4:185884834-185884856 ATACTCCTCTTTCAGTTCTTGGG + Intronic
985796793 5:1968196-1968218 ATACTCCGCATAAAGTCCTTTGG + Intergenic
987764305 5:22205185-22205207 ATATTCCAAATTAATTTCTGTGG - Intronic
988666274 5:33331489-33331511 ATATTCCACATTATATTATTTGG + Intergenic
989322456 5:40152131-40152153 ATATACCACATTATGTACTTAGG + Intergenic
989642947 5:43601273-43601295 ATATTCCCTATTAAGTTTTAAGG - Intergenic
990261235 5:54024902-54024924 TTATTCCACATTAACTTATTTGG - Intronic
991470075 5:66958698-66958720 CTATTCCTCATTTATTTCTTGGG + Intronic
991536108 5:67670700-67670722 ATATTCCCCAAAATGTACTTGGG + Intergenic
991899039 5:71438315-71438337 ATATTCCAAATTAATTTCTGTGG - Intergenic
994560031 5:101356991-101357013 ATATTCCCAATTCAGGTATTTGG - Intergenic
997114847 5:131115279-131115301 ATCTTGTCCATTATGTTCTTAGG + Intergenic
998696797 5:144650037-144650059 ATATCCTCCATTCAATTCTTAGG + Intergenic
1003028662 6:2581009-2581031 ATGTACCCCATTAAGTTGTAAGG + Intergenic
1007351891 6:41279588-41279610 TTTTTCCCCATTATGTTGTTTGG - Intronic
1009276698 6:61690902-61690924 ATATTACCAATTAAGATCATAGG + Intronic
1010027403 6:71235671-71235693 ATATTCCTGTTTAGGTTCTTGGG - Intergenic
1011714539 6:90091086-90091108 TTATTCCCCAATAAGTTTGTAGG + Intronic
1012387863 6:98703011-98703033 ATATTCCCAAATAATTTCTCAGG + Intergenic
1013303635 6:108827684-108827706 TTTTTCCCCATTAATTTCTTTGG - Intergenic
1013624790 6:111926417-111926439 AGGTTCCCCATTGAGTTGTTGGG - Intergenic
1013828953 6:114249875-114249897 ATATCCCCATTTAAGTTCCTTGG - Intronic
1013851152 6:114517706-114517728 CTCTTCCCTATGAAGTTCTTGGG + Intergenic
1014162668 6:118187982-118188004 ACATTCAGTATTAAGTTCTTTGG - Intronic
1014512826 6:122345508-122345530 TTATTGTCCAATAAGTTCTTGGG + Intergenic
1017943671 6:159076206-159076228 ATTTATCCCATTAACTTCTTTGG - Intergenic
1018516820 6:164590544-164590566 ATTTTGCCCATTAAATTGTTTGG - Intergenic
1025582365 7:62736555-62736577 ATAGTCACCATTAACATCTTTGG - Intergenic
1025600611 7:62992973-62992995 ATAGTCACCATTAACATCTTTGG - Intergenic
1026281703 7:68928103-68928125 ATATCAGCCATTAAGTTGTTTGG + Intergenic
1028326822 7:89538230-89538252 ATGTTCCTCATTAAGTGCATGGG - Intergenic
1028746249 7:94329916-94329938 ATTTTCCCTATTAAGTACTTTGG + Intergenic
1029333182 7:99877362-99877384 TTATTCCCCATTTACTTCCTAGG + Intronic
1031255748 7:119445975-119445997 ACATTGACCATTGAGTTCTTCGG + Intergenic
1034932729 7:155175455-155175477 TTGTTCCCCAATAAGTTATTAGG + Intergenic
1036273833 8:7333114-7333136 ATTCTCTCCATTGAGTTCTTCGG - Intergenic
1036274414 8:7337842-7337864 ATTCTCTCCATTGAGTTCTTCGG - Intergenic
1036274957 8:7342554-7342576 ATTCTCTCCATTGAGTTCTTCGG - Intergenic
1036346397 8:7967794-7967816 ATTCTCTCCATTGAGTTCTTCGG + Intergenic
1036346935 8:7972504-7972526 ATTCTCTCCATTGAGTTCTTCGG + Intergenic
1036347513 8:7977236-7977258 ATTCTCTCCATTGAGTTCTTCGG + Intergenic
1036841720 8:12128547-12128569 ATTCTCTCCATTGAGTTCTTCGG + Intergenic
1036842264 8:12133260-12133282 ATTCTCTCCATTGAGTTCTTTGG + Intergenic
1036842820 8:12138011-12138033 ATTCTCTCCATTGAGTTCTTCGG + Exonic
1036863538 8:12374797-12374819 ATTTTATCCATTGAGTTCTTCGG + Intergenic
1036864098 8:12379515-12379537 ATTCTCTCCATTGAGTTCTTTGG + Intergenic
1037079309 8:14764000-14764022 CTATTCCCTATCAAGTTCCTTGG + Intronic
1042380769 8:68111707-68111729 ATATTGCACATTAAGTTGTGTGG - Intronic
1042462893 8:69091470-69091492 TTATTCTACTTTAAGTTCTTGGG + Intergenic
1043821539 8:84871998-84872020 ATATTCCCCAGAAATTTCTGAGG - Intronic
1044957600 8:97497882-97497904 ATATTTGCAACTAAGTTCTTGGG - Intergenic
1049161730 8:141102472-141102494 CTTTTCCCCATCCAGTTCTTTGG + Intergenic
1049738857 8:144224918-144224940 AGATTCCCCTTTAAGGTTTTTGG + Intronic
1050883385 9:10733449-10733471 ATATTTCCTATTAATTTTTTAGG - Intergenic
1054710362 9:68504859-68504881 ATATTGACCATTAATTACTTTGG + Intronic
1055820786 9:80260267-80260289 ATAGCCACCATTAATTTCTTTGG - Intergenic
1056979554 9:91296469-91296491 ATATGACCTATTAAGCTCTTTGG - Intronic
1057588605 9:96351867-96351889 AAATCCCTCATTAAGTTCTTAGG + Intronic
1059503309 9:114775343-114775365 GTAATCCCCATTCAGTTCTTGGG + Intergenic
1188495783 X:30781668-30781690 TTTTTCCCCATCAAGTTCTGGGG + Intergenic
1188761040 X:34030202-34030224 ATTTTCCCCATTAAATGATTTGG - Intergenic
1196547628 X:116981590-116981612 ATATTCTACTTTAAGTTCTGGGG - Intergenic
1197354805 X:125424893-125424915 ACATTTCCCATTAAATTCATTGG - Intergenic
1198632293 X:138654156-138654178 ACATTCTCCATAAAGTTGTTAGG + Intronic