ID: 921367392

View in Genome Browser
Species Human (GRCh38)
Location 1:214386626-214386648
Sequence ATTGGCTGCTCAGGGAGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921367392_921367402 18 Left 921367392 1:214386626-214386648 CCCCGACTCCCTGAGCAGCCAAT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 921367402 1:214386667-214386689 TCAGAGGTAACTGACAGTCTAGG 0: 1
1: 0
2: 0
3: 10
4: 146
921367392_921367401 2 Left 921367392 1:214386626-214386648 CCCCGACTCCCTGAGCAGCCAAT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 921367401 1:214386651-214386673 TGGGGAAATTTTTTGATCAGAGG 0: 1
1: 0
2: 1
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921367392 Original CRISPR ATTGGCTGCTCAGGGAGTCG GGG (reversed) Intronic