ID: 921367392 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:214386626-214386648 |
| Sequence | ATTGGCTGCTCAGGGAGTCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 105 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 4, 4: 99} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921367392_921367402 | 18 | Left | 921367392 | 1:214386626-214386648 | CCCCGACTCCCTGAGCAGCCAAT | 0: 1 1: 0 2: 1 3: 4 4: 99 |
||
| Right | 921367402 | 1:214386667-214386689 | TCAGAGGTAACTGACAGTCTAGG | 0: 1 1: 0 2: 0 3: 10 4: 146 |
||||
| 921367392_921367401 | 2 | Left | 921367392 | 1:214386626-214386648 | CCCCGACTCCCTGAGCAGCCAAT | 0: 1 1: 0 2: 1 3: 4 4: 99 |
||
| Right | 921367401 | 1:214386651-214386673 | TGGGGAAATTTTTTGATCAGAGG | 0: 1 1: 0 2: 1 3: 23 4: 225 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921367392 | Original CRISPR | ATTGGCTGCTCAGGGAGTCG GGG (reversed) | Intronic | ||