ID: 921367929

View in Genome Browser
Species Human (GRCh38)
Location 1:214392221-214392243
Sequence TAATTTTGAGAGCGTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921367929 Original CRISPR TAATTTTGAGAGCGTGCCCC AGG Intronic
907034315 1:51202727-51202749 TGACTTAGAGAGAGTGCCCCAGG - Intergenic
910559819 1:88578357-88578379 TTATTTTGAGAGGATGTCCCAGG - Intergenic
914781425 1:150789272-150789294 TTATTTTGTGAGCGTGTCCGTGG + Intergenic
915929006 1:160046826-160046848 TTATTTTGCGGGGGTGCCCCGGG - Intronic
918698379 1:187575336-187575358 TGCTTTTGAGAGCGCGCTCCTGG + Intergenic
921367929 1:214392221-214392243 TAATTTTGAGAGCGTGCCCCAGG + Intronic
1068105753 10:52613798-52613820 TAATTTTCAGAGCGTGGCCAGGG + Intergenic
1069839021 10:71327752-71327774 TCCTTTGGAGAGCCTGCCCCTGG + Intronic
1081162490 11:39767087-39767109 TAATTATGAGAGCATGGCCATGG - Intergenic
1091077991 11:132639308-132639330 ACATTTTGAGAGCATGCCTCTGG - Intronic
1096441826 12:51649701-51649723 TAATTTTGTGAGCTGGGCCCAGG - Intronic
1099589499 12:84569484-84569506 TAATTTTGAGAGATAGCTCCTGG - Intergenic
1111985582 13:95063102-95063124 TCATTTTGGGAGTGTGCTCCTGG - Intronic
1117776697 14:59190306-59190328 TAATTTTCAGAGTTTGCCTCAGG - Intronic
1122030492 14:98908218-98908240 TAATTTGGAAACAGTGCCCCAGG - Intergenic
1127122838 15:55786196-55786218 GAATTTTGAGAGCAGGCCCGTGG - Intergenic
1130157313 15:81362774-81362796 GGATTCTGAGAGTGTGCCCCAGG + Intronic
1130169389 15:81496109-81496131 TAATTTTGAGAGCTGGCCTGAGG + Intergenic
1131513387 15:93062121-93062143 TCATTTTGAGTGCAAGCCCCAGG + Intronic
1133322332 16:4922052-4922074 TAATTTTGTGCGGGTGCCACTGG + Intronic
1137476672 16:48815194-48815216 TCATTTGGTCAGCGTGCCCCGGG + Intergenic
1141374343 16:83516321-83516343 TAATTTTGAGACCTTGAGCCAGG + Intronic
1144899341 17:18569490-18569512 TCATTTTGAGTGCAAGCCCCAGG - Intergenic
1157555718 18:48611821-48611843 TAATGCTGAGATCGTGACCCAGG + Intronic
1158402887 18:57137213-57137235 TAAGTTTGGGAGCCTGCCCAAGG + Intergenic
1161085623 19:2333620-2333642 TCATTTTGAGAGCGTGGCAAGGG + Intronic
932699442 2:73983552-73983574 TGATTTTGACAGCCTGCTCCAGG - Intergenic
933747202 2:85579933-85579955 TAATTTGGGGAGCATGGCCCCGG + Intronic
936650394 2:114419673-114419695 TAATTTTGAGAGCAGACCACAGG - Intergenic
940719900 2:157270818-157270840 TAATTTTGAGAGGGTAGGCCAGG + Intronic
942444045 2:176066731-176066753 AAGTTCTGAGAGCCTGCCCCGGG - Intergenic
943050229 2:182905063-182905085 TAATTTTGAGACTGTGGCCTGGG - Intergenic
947803980 2:232951910-232951932 GTATTTTGATAGCATGCCCCTGG - Intronic
948075266 2:235160994-235161016 TAATTTTGAGAACTTGCACTTGG + Intergenic
1170258357 20:14372947-14372969 GAATTTTGACAGTATGCCCCAGG - Intronic
1184471752 22:44700018-44700040 TAAGTTTGAGAGCGTGGGCTAGG + Intronic
961174365 3:124821599-124821621 TGGTTTTGTGAGTGTGCCCCAGG - Intronic
962931064 3:140036508-140036530 GTATTTTGAGACCATGCCCCTGG - Intronic
971419935 4:26465934-26465956 TAATTTAGAGAGTGTTCCCGTGG - Intergenic
972084932 4:35204653-35204675 TAAGGTTGAGAGTGTGACCCAGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
977598277 4:98908095-98908117 TAATTTAGAGAGCATACCCTAGG - Intronic
988882462 5:35517935-35517957 TAATTTTTAAAGCTTTCCCCAGG - Intergenic
995809763 5:116092136-116092158 TAATTTTGAGAAAGTGCTTCTGG + Intronic
997689012 5:135813030-135813052 TAATTATGAGAGGGGCCCCCGGG + Intergenic
998921734 5:147075860-147075882 TATTTTTGAGAATGTGTCCCAGG + Intronic
1005040488 6:21595770-21595792 AAACTTTGAGAGCATGTCCCTGG + Exonic
1006794652 6:36723991-36724013 AAAGTTTGAGAACCTGCCCCAGG - Intronic
1007173988 6:39883953-39883975 GAATTTTAGGAGCGTGTCCCTGG + Exonic
1026944656 7:74307847-74307869 TAATTTTGGGAGCGTTCCCTGGG + Intronic
1029632172 7:101759623-101759645 TTATTTTGAGACAGTGGCCCAGG + Intergenic
1032345113 7:131109858-131109880 TCATTTTGTTCGCGTGCCCCTGG + Intergenic
1035009875 7:155705580-155705602 TAATATTGAAAGCGTACCCTTGG + Intronic
1038088282 8:24224651-24224673 TAATTTGGAGAGGGTGTCACCGG - Intergenic
1042028544 8:64449323-64449345 TAATTGTGAGGACGGGCCCCAGG + Intergenic
1044480915 8:92687078-92687100 TTATTTTCAGAGAGTTCCCCAGG - Intergenic
1058155664 9:101511892-101511914 GACTTTTGAGAGCATGCACCAGG - Intronic
1186110262 X:6247768-6247790 CACTTTAGAGAGCTTGCCCCTGG + Intergenic
1199886730 X:152027881-152027903 CATTTTTGAGAGTGTGCACCTGG - Intergenic