ID: 921371273

View in Genome Browser
Species Human (GRCh38)
Location 1:214425125-214425147
Sequence CTAGCCCAGAAGTACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 143}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921371270_921371273 2 Left 921371270 1:214425100-214425122 CCATCAATCTCTATTTAGCACCC 0: 1
1: 0
2: 0
3: 12
4: 117
Right 921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 143
921371268_921371273 7 Left 921371268 1:214425095-214425117 CCAGCCCATCAATCTCTATTTAG 0: 1
1: 0
2: 0
3: 13
4: 153
Right 921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 143
921371266_921371273 17 Left 921371266 1:214425085-214425107 CCAGGTCCATCCAGCCCATCAAT 0: 1
1: 0
2: 0
3: 13
4: 124
Right 921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 143
921371265_921371273 20 Left 921371265 1:214425082-214425104 CCACCAGGTCCATCCAGCCCATC 0: 1
1: 0
2: 2
3: 31
4: 340
Right 921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 143
921371267_921371273 11 Left 921371267 1:214425091-214425113 CCATCCAGCCCATCAATCTCTAT 0: 1
1: 0
2: 1
3: 19
4: 237
Right 921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 143
921371264_921371273 27 Left 921371264 1:214425075-214425097 CCATGGGCCACCAGGTCCATCCA 0: 1
1: 0
2: 8
3: 32
4: 333
Right 921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 143
921371269_921371273 3 Left 921371269 1:214425099-214425121 CCCATCAATCTCTATTTAGCACC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921371273 Original CRISPR CTAGCCCAGAAGTACCTTGA AGG Intronic
900865487 1:5266006-5266028 CTAGCCCATGAGCTCCTTGAAGG - Intergenic
903474534 1:23610484-23610506 CTAGCCCAGGAGCTCCTTGAGGG + Intronic
907264627 1:53249937-53249959 CTAACCCATAAGATCCTTGAGGG - Intronic
907909058 1:58811259-58811281 CTAGACTAGAAGTTCCATGAGGG - Intergenic
909900667 1:81130676-81130698 CTGGGCTAGAAATACCTTGAAGG + Intergenic
909900830 1:81132655-81132677 CTGGACTAGAAATACCTTGAAGG + Intergenic
917731288 1:177877396-177877418 CTAGACCATAAGTTCCTAGAAGG + Intergenic
920046988 1:203139715-203139737 CTAGCCTATAAGTTCCATGAGGG - Intronic
920432931 1:205930158-205930180 CTAGCGTAGCAGTAGCTTGAGGG + Intronic
921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG + Intronic
922972712 1:229756655-229756677 TTATCCCAGTAGTAACTTGAGGG + Intergenic
923332146 1:232935144-232935166 CTAACCCAGAAGTACAGTGGAGG - Intergenic
1066802407 10:39206340-39206362 CTGGCTCAGAAGGACCTTGGAGG + Intergenic
1068448406 10:57153667-57153689 GTATCCCAGAAGTATGTTGAAGG + Intergenic
1070191377 10:74114733-74114755 CTTGCCCACAAGCTCCTTGAAGG - Intronic
1071008595 10:80911762-80911784 CTAGACTAGAAATACATTGAGGG + Intergenic
1075815962 10:125265112-125265134 CGAGCCAACAAGTACCTGGAAGG + Intergenic
1077121054 11:908701-908723 CTGGCCCAGGAGTAACTGGAGGG + Intronic
1079414740 11:20223269-20223291 TTAGCCTAGGAGTACCCTGAGGG + Intergenic
1085137023 11:74100415-74100437 ATAGCCCAGTAATCCCTTGAAGG - Intronic
1087051957 11:93895392-93895414 TTAGACCAGAAGAAACTTGAGGG + Intergenic
1089842973 11:121434876-121434898 CTAACCCATAACTACCTGGAAGG + Intergenic
1090216898 11:124975585-124975607 CTAGCACAGAAGCTCCTTGAGGG - Intronic
1090251599 11:125255566-125255588 CTAACACAGAAATTCCTTGAGGG - Intronic
1091202584 11:133793461-133793483 TTAGTTCAGAAGTACCTGGAAGG - Intergenic
1091681465 12:2530519-2530541 CAAGGCCAGAAGGACCATGATGG + Intronic
1097271244 12:57775716-57775738 CTTCCCCAGAAGAAGCTTGAAGG - Intronic
1098044875 12:66390001-66390023 CTAGTGCAGAATGACCTTGAGGG + Intronic
1101526231 12:105533700-105533722 CTAGCTCATAAGTTCCATGAGGG + Intergenic
1102455223 12:113066768-113066790 CCAGAACAGAAGCACCTTGAGGG - Intronic
1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG + Intronic
1106556360 13:30811883-30811905 CCAGCCCCGAAGTACGTAGAAGG + Intergenic
1106556368 13:30811910-30811932 CCAGCCCCGAAGTACGTAGAAGG + Intergenic
1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG + Intergenic
1112719056 13:102221817-102221839 CTAGACTACAAGTTCCTTGAAGG + Intronic
1120026266 14:79588139-79588161 CTCACCCATAAGTAGCTTGAAGG + Intronic
1120784494 14:88519981-88520003 CTCTACCAGAAGTACCTAGAGGG + Intronic
1122025604 14:98873548-98873570 CTAGACCAGAAGTTGCTTGAGGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124486855 15:30125297-30125319 CCAGCCCAGAAGATCCATGAAGG - Intergenic
1124541937 15:30594274-30594296 CCAGCCCAGAAGATCCATGAAGG - Intergenic
1124548587 15:30656065-30656087 CCAGCCCAGAAGATCCATGAAGG - Intronic
1124756670 15:32413026-32413048 CCAGCCCAGAAGATCCATGAAGG + Intergenic
1125689526 15:41585189-41585211 CGAGCCCAGAAGCACCTGGTGGG + Intergenic
1127669383 15:61180707-61180729 CTAGACCATGAGCACCTTGAAGG + Intronic
1128515307 15:68338357-68338379 CTGGCCCAGAAGCAGCTTGAGGG + Intronic
1128706449 15:69840574-69840596 TTAGACTAGAAGTTCCTTGAGGG - Intergenic
1129332896 15:74836858-74836880 CAAGCACAGAAGTACCCTGCGGG + Exonic
1134591804 16:15460749-15460771 CCAGCCCACAAATTCCTTGAGGG - Intronic
1136074863 16:27810131-27810153 CTAGGCCAGAAGGACTCTGAGGG - Intronic
1137385215 16:48035567-48035589 CTAGACCAGAAGTGTCTTGAAGG - Intergenic
1139447257 16:67005483-67005505 CTAGCCCAGAAGTACAGAGAGGG - Intronic
1142528900 17:565475-565497 CTAGGCCAGAAGCTCTTTGAGGG - Intronic
1146156288 17:30526848-30526870 CTATCCCCAAACTACCTTGATGG - Exonic
1146213381 17:30959187-30959209 CTAGACCATAAGTTCCTTGAAGG - Exonic
1149917600 17:60625509-60625531 AAAGGCCAGAAGTAACTTGAAGG + Intronic
1153582710 18:6591103-6591125 CTAGCACAGCAGGACCTTGCTGG - Intergenic
1156042894 18:32843409-32843431 CCAGCCCAGAAGCATCTTGTGGG - Intergenic
1156401241 18:36742287-36742309 CTAGCCGTGGAGTGCCTTGAGGG + Intronic
1156668369 18:39436463-39436485 CTAGTTAATAAGTACCTTGAGGG - Intergenic
1157185480 18:45536919-45536941 CTAGACCACAAGGTCCTTGAAGG - Intronic
1157611492 18:48959346-48959368 CTAACCCAGATGGACCCTGATGG + Intergenic
1158290758 18:55939284-55939306 CTAGCCCTGCAGTACGTTGTAGG - Intergenic
1158564701 18:58544952-58544974 CTTCCCCAGAAGTCCCTTGGTGG - Intronic
1159144133 18:64431643-64431665 ATAGCCCAGATGTCCATTGATGG - Intergenic
1166631124 19:44409013-44409035 CTGGCCCCGAAGTATCTAGATGG + Intergenic
926529028 2:14018610-14018632 CTAGACCATGAGTTCCTTGAGGG - Intergenic
927682139 2:25146708-25146730 TTAGCCCAGAGGTAGCTTGGTGG + Intronic
927826061 2:26311055-26311077 GTAGCCCAGGAGCACCATGAGGG + Exonic
929745846 2:44657477-44657499 CTTGGCCAGAAATATCTTGATGG - Intronic
933669239 2:84991114-84991136 CTGGCCCAGATGTATCTTGAAGG + Intronic
933744226 2:85559006-85559028 CTGGACCGGAAATACCTTGATGG - Exonic
935349430 2:102141079-102141101 CCAGCCCAGAAGCACTATGATGG - Intronic
935367389 2:102308740-102308762 CTAACTCAGGAGGACCTTGATGG + Intergenic
935814881 2:106838280-106838302 CTGGCCCAGCAGCTCCTTGAAGG - Intronic
937378402 2:121353650-121353672 CTAGACTAAAAGTTCCTTGAAGG + Intronic
937478793 2:122238600-122238622 CTAGCCGGGAAGGACCCTGAAGG - Intergenic
937657909 2:124398177-124398199 CTAGGCAACAAGTACTTTGAGGG - Intronic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
942122807 2:172794863-172794885 TTAGCCCAGAAATACCTATAAGG + Intronic
943132733 2:183875200-183875222 CTAGCCCTGAAGTAACTCAAGGG - Intergenic
943401380 2:187415646-187415668 GTAGCCCAGAATGTCCTTGAGGG - Intronic
948462793 2:238138489-238138511 CTAGGCCACAAGTCCCTGGAAGG + Intergenic
1169801577 20:9516603-9516625 CTAGATAAGAAGTCCCTTGAAGG + Intronic
1172752947 20:37263737-37263759 CTATCCCTGAGGTACCTCGATGG + Intergenic
1172864450 20:38084979-38085001 CTAGCCCAGAAGAGCCGTGGGGG - Intronic
1180762964 22:18223137-18223159 CCAGGCCAGAGGTACCTTGCAGG + Intergenic
1180772679 22:18401410-18401432 CCAGGCCAGAGGTACCTTGCAGG - Intergenic
1180804059 22:18651026-18651048 CCAGGCCAGAGGTACCTTGCAGG - Intergenic
1180806716 22:18718451-18718473 CCAGGCCAGAGGTACCTTGCAGG + Intergenic
1181217660 22:21344233-21344255 CCAGGCCAGAGGTACCTTGCAGG + Intergenic
1184213566 22:43051529-43051551 CTAGCCCAGATGCACCCTGGAGG + Intronic
1203234517 22_KI270731v1_random:142398-142420 CCAGGCCAGAGGTACCTTGCAGG - Intergenic
949945195 3:9184605-9184627 CTAGGCTATAAATACCTTGAAGG - Intronic
950635155 3:14308917-14308939 CTAGACCAGGAGTTCCTTGAGGG - Intergenic
950721711 3:14887634-14887656 CTAGACCATCAGTGCCTTGAGGG - Intronic
951187866 3:19735254-19735276 ATAGCACAGAAGAACCTTCATGG + Intergenic
954140281 3:48601419-48601441 CTCGCCCAGAAGCACCTCGGTGG - Exonic
960925447 3:122791520-122791542 TTAGATCATAAGTACCTTGAGGG - Intronic
966264702 3:178025633-178025655 CTAGGCTACAAGTTCCTTGAGGG - Intergenic
968870086 4:3237485-3237507 CTAGACCACAAGCCCCTTGAAGG - Intronic
970379513 4:15492904-15492926 GTAGCCCAGAATGCCCTTGAGGG + Intronic
970790988 4:19857405-19857427 CTAACGCAGATGTTCCTTGATGG + Intergenic
973272176 4:48272255-48272277 CTAGCACAGATGTACTTTGAGGG + Intergenic
976782194 4:88773413-88773435 CTAACCCACAGCTACCTTGATGG - Intronic
979570723 4:122220911-122220933 AGAGCCCAGAGGTATCTTGAAGG - Intronic
980803420 4:137782678-137782700 CAAGCCCAGAACTGCCTTGGTGG + Intergenic
981672446 4:147302309-147302331 CTACTTCAGAATTACCTTGAGGG + Intergenic
984789387 4:183600986-183601008 CTAGACCAGTAGTTCCTTGTTGG - Intergenic
984931148 4:184848058-184848080 CTAGCCTAGAAGCACCTTAAGGG - Intergenic
987868074 5:23572708-23572730 CTAGCCCCAAAGTACCTCCAGGG - Intergenic
996501721 5:124224443-124224465 CTATCTCAGAAGTGGCTTGAGGG - Intergenic
998618729 5:143771182-143771204 CTAGCCCAGAAATAACTTGCAGG - Intergenic
999310996 5:150552115-150552137 CAAGACCAGGAGTTCCTTGAAGG - Intronic
1001409523 5:171500727-171500749 CTGTCCCAGAACCACCTTGATGG + Intergenic
1001645395 5:173277961-173277983 CTAACACAGAAGTTCCTTGAGGG - Intergenic
1003328493 6:5110509-5110531 CTTGCACAGAGGTATCTTGAAGG + Intronic
1005821067 6:29599609-29599631 CTAGCCCACAAAAACCATGATGG + Intronic
1007809637 6:44476820-44476842 GCAGCCCAGGAGTCCCTTGAGGG + Intergenic
1010107598 6:72187786-72187808 CCAGCCCAGAAATCTCTTGATGG + Intronic
1012096758 6:94972063-94972085 GAAGTCCAGAAGTACCTTGCCGG - Intergenic
1017734368 6:157347795-157347817 CTAGACCAAGAGTTCCTTGAGGG + Intergenic
1020776059 7:12455271-12455293 CTTGCCCAGAATTACCTAGTTGG - Intergenic
1022903640 7:34834749-34834771 CTAGCAAAGAAGCACCTTGGAGG + Intronic
1024132968 7:46375255-46375277 ATATCCAAAAAGTACCTTGAAGG - Intergenic
1025956944 7:66190211-66190233 GTAGCCCAGAAGTGCCTGGTGGG + Intergenic
1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG + Intronic
1029946402 7:104537886-104537908 CTGCCCAAGAAGGACCTTGATGG - Intronic
1030406091 7:109115459-109115481 CTAGCCTTGAAGTATCTTCATGG + Intergenic
1030408256 7:109142759-109142781 TGGGCCCAGAAGTACCTTCAGGG + Intergenic
1032389344 7:131545922-131545944 CTAGCCCAGACTTACCATGTGGG + Intronic
1033940985 7:146653409-146653431 CTAGCCGAGAAGCTCCATGAAGG - Intronic
1034328831 7:150264412-150264434 CTTCTCCAGAAGCACCTTGATGG - Intronic
1034669217 7:152845338-152845360 CTTCTCCAGAAGCACCTTGATGG + Intronic
1036497671 8:9284172-9284194 CTAGACCTTAAGTTCCTTGAGGG - Intergenic
1037150630 8:15631202-15631224 ATAGCTCAGCAGTAACTTGAGGG - Intronic
1038441173 8:27571776-27571798 CCAGGCCAGAAGGACCCTGAAGG - Intergenic
1039241147 8:35558157-35558179 CCAACCCAGAAGCTCCTTGAGGG + Intronic
1049445326 8:142627835-142627857 CCAGCCCGGGAGCACCTTGAGGG + Intergenic
1049671391 8:143871653-143871675 CTGGCCCAGCAGTACCAGGAAGG - Exonic
1051872729 9:21757433-21757455 CTAGCCTATAAGTTCTTTGAAGG + Intergenic
1053057465 9:35002249-35002271 TTGACCCATAAGTACCTTGAGGG + Intergenic
1055711261 9:79064278-79064300 CTAGCCTACAAATGCCTTGAGGG + Intergenic
1057513120 9:95697514-95697536 TTAGACCAGAAGTTCCTTGAGGG - Intergenic
1058903277 9:109460273-109460295 TGAGCCCAGAAGTACTTTGAAGG - Intronic
1060799683 9:126535623-126535645 CTAGGCCATGAATACCTTGAGGG + Intergenic
1186143104 X:6597892-6597914 CTAATACAGAAGTACCCTGATGG - Intergenic
1187599659 X:20814201-20814223 CTAGACCATGAGTTCCTTGAAGG + Intergenic
1188530261 X:31132639-31132661 ATTGACCATAAGTACCTTGAAGG + Intronic
1188944537 X:36282313-36282335 CTAGGGCAGAAGAACCATGAAGG + Intronic
1189028191 X:37421035-37421057 CTTGCACTGAAGAACCTTGAGGG + Intronic
1189273157 X:39765982-39766004 CCAGTTCAGAAGTTCCTTGAGGG + Intergenic
1189457627 X:41207691-41207713 CTGGCCGGGAAGCACCTTGAAGG - Intronic
1190448440 X:50554317-50554339 CTAGCTAAGAAGTACCTGGATGG + Intergenic
1190937469 X:55009442-55009464 CTGGCCCTGAGGTATCTTGAAGG - Intronic
1192295477 X:69843065-69843087 CTAACCCATAAGCTCCTTGAAGG - Intronic
1193976691 X:88129059-88129081 TTAGCCCAGATGTACGTTCAGGG - Intergenic
1196811679 X:119634015-119634037 CTAGACCATGAGTTCCTTGATGG - Intronic
1199810415 X:151343406-151343428 ATAGCCAGGAAGTACCTAGATGG + Intergenic
1199811165 X:151351085-151351107 CTAGACCAGAAGTCCTTTGTGGG - Intergenic
1199860741 X:151798664-151798686 CTAGACCAGAAGTTTCTTGAAGG - Intergenic