ID: 921372732

View in Genome Browser
Species Human (GRCh38)
Location 1:214441504-214441526
Sequence ATGCTGATATTCAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 643}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921372728_921372732 -7 Left 921372728 1:214441488-214441510 CCAACTGAATGTCCCAATGCTGA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 643
921372727_921372732 -2 Left 921372727 1:214441483-214441505 CCACTCCAACTGAATGTCCCAAT 0: 1
1: 0
2: 0
3: 7
4: 139
Right 921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 643
921372726_921372732 3 Left 921372726 1:214441478-214441500 CCACTCCACTCCAACTGAATGTC 0: 1
1: 0
2: 0
3: 18
4: 245
Right 921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 643
921372723_921372732 12 Left 921372723 1:214441469-214441491 CCTCTCCACCCACTCCACTCCAA 0: 1
1: 0
2: 53
3: 131
4: 1369
Right 921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 643
921372722_921372732 16 Left 921372722 1:214441465-214441487 CCTTCCTCTCCACCCACTCCACT 0: 1
1: 1
2: 18
3: 165
4: 1186
Right 921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 643
921372724_921372732 7 Left 921372724 1:214441474-214441496 CCACCCACTCCACTCCAACTGAA 0: 1
1: 0
2: 0
3: 24
4: 310
Right 921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 643
921372725_921372732 4 Left 921372725 1:214441477-214441499 CCCACTCCACTCCAACTGAATGT 0: 1
1: 0
2: 1
3: 16
4: 174
Right 921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921372732 Original CRISPR ATGCTGATATTCAGGAAAAA AGG Intronic
900010851 1:106545-106567 AGGATAATATTCAGGAAATATGG + Intergenic
900026953 1:283109-283131 AGGATAATATTCAGGAAATATGG + Intergenic
901224449 1:7604953-7604975 CTGCTGATATCCAGGCAAACAGG - Intronic
905007922 1:34725917-34725939 AAGCTGATATTCAGAGAAAGAGG - Intronic
906577888 1:46907367-46907389 ATGGTGATTTTCAGGGAACAAGG + Intergenic
906605466 1:47166772-47166794 CTGCTGATATCCAGGCAAACAGG + Intergenic
907734032 1:57094366-57094388 TTGCTGAGACTCAGGAAGAAGGG - Intronic
907876114 1:58489810-58489832 CTGCTGATATCCAGGCAAACAGG + Intronic
907926451 1:58958989-58959011 CTGCTGATATCCAGGCAAACAGG + Intergenic
908222159 1:62018211-62018233 ATATTTATATACAGGAAAAATGG - Intronic
908621560 1:65986942-65986964 ATGCAGATATACTGGGAAAAAGG + Intronic
909307220 1:74096821-74096843 ATGCTGATACCCAGGCAAATAGG - Intronic
909792222 1:79693787-79693809 ATGCTGAGATTCTGGAGAAAAGG - Intergenic
910525153 1:88169311-88169333 ACGCTGAAGTTCAGGAAAACAGG + Intergenic
910578240 1:88791791-88791813 ATCCAGATATTTAGGGAAAATGG + Intronic
910816639 1:91297659-91297681 CTGCTGATACCCAGGAAAACAGG + Intronic
910945766 1:92589983-92590005 CTGCTGATATACAGGCAAACAGG + Intronic
911333361 1:96551546-96551568 ATGCATATATTCACTAAAAAAGG - Intergenic
911371928 1:97004219-97004241 AGCCTGATATTCAGAAAAGAAGG + Intergenic
911517116 1:98880902-98880924 CTGGTGATATTCAGGCAAACAGG - Intergenic
911572432 1:99534110-99534132 ATGCTGCTGTTAAGGAACAAAGG - Intergenic
913200682 1:116493480-116493502 AAGCTGATACTCAGGTAAGAAGG + Intergenic
913343928 1:117789043-117789065 ATGGTGATATTCACCAAAATAGG - Intergenic
915631109 1:157154779-157154801 ACCCTGATACTCAGGAAGAATGG + Intergenic
915760300 1:158304805-158304827 CTGCTGATACCCAGGAAAACAGG + Intergenic
915763307 1:158336938-158336960 CTGCTGATATCCAGGCAAACAGG + Intergenic
915987390 1:160480576-160480598 CTGCTGATACCCAGGAAAACAGG - Intergenic
916258470 1:162815292-162815314 ATCATCAGATTCAGGAAAAATGG + Intergenic
916401074 1:164448956-164448978 GTGCTGATATTCAAGACAATGGG - Intergenic
916772222 1:167921534-167921556 ATGCTGATGTTAAAGAAAAATGG - Intronic
917129677 1:171728207-171728229 ATGTGGATATGCAGGACAAAGGG - Intronic
917167245 1:172126019-172126041 AGGCAGACATTCAGGAAAAATGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917915323 1:179695189-179695211 CTGGTGATATCCAGGCAAAAAGG + Intergenic
918089512 1:181276714-181276736 CTGCTGATACCCAGGAAAACAGG + Intergenic
918261189 1:182797966-182797988 GTGCTGATAGTCGAGAAAAAGGG + Intronic
918541598 1:185638484-185638506 CTGCTGATACCCAGGAAAACAGG + Intergenic
918548115 1:185708247-185708269 CTGCTGATACCCAGGCAAAAGGG + Intergenic
918593071 1:186261864-186261886 CTGCTGATACCCAGGAAAACAGG - Intergenic
918704367 1:187641850-187641872 ATGCTGATATTGTGGAGAAGAGG - Intergenic
918817352 1:189205661-189205683 ATGTTGGTTTTCAGAAAAAAAGG + Intergenic
920648368 1:207819327-207819349 CTGCTGAGATTCAGAAAGAAGGG + Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921656872 1:217749875-217749897 ATGCTCATATTGAGGAGCAAAGG - Intronic
922066308 1:222146614-222146636 CTGGTGATACCCAGGAAAAAGGG + Intergenic
922869273 1:228887650-228887672 ATAATGATATTTAGAAAAAATGG - Intergenic
923991879 1:239446965-239446987 ATAATGATATTCAGAATAAAAGG + Intronic
924285520 1:242481927-242481949 CTGCTGATACTCAGGAAAACAGG + Intronic
924550975 1:245076686-245076708 ATGCAGAAATGCAGAAAAAATGG - Intronic
924820634 1:247487135-247487157 CAGCTGATATTCAAGAAAATTGG + Intergenic
924957472 1:248943719-248943741 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1063283734 10:4660748-4660770 ATGCTAATGTTCAGGAGAAAGGG - Intergenic
1063284017 10:4663108-4663130 ATCCTAATGTTCAGGAGAAAGGG + Intergenic
1064474255 10:15669786-15669808 CTGCTGATACCCAGGAAAACAGG - Intronic
1064567687 10:16659010-16659032 TTGCTAATATACATGAAAAATGG - Intronic
1064589657 10:16875700-16875722 ATGCTGATATTGTGCAAAGATGG - Intronic
1064864514 10:19864587-19864609 ATGCTGATATTTGGCAAAATGGG + Intronic
1064914478 10:20441477-20441499 CTGCTGATATCCAGGCAAACAGG - Intergenic
1064931050 10:20627481-20627503 ATGCCACTTTTCAGGAAAAATGG - Intergenic
1065157646 10:22886505-22886527 CTGCTGATACACAGGAAAACAGG + Intergenic
1065594852 10:27300097-27300119 CTGCTGATACCCAGGAAAACAGG + Intergenic
1065780556 10:29162632-29162654 AGGCAGATAGACAGGAAAAAGGG - Intergenic
1066060396 10:31718949-31718971 CTGCTGATAACCAGGAAAACAGG - Intergenic
1066724913 10:38380980-38381002 ATCATCAGATTCAGGAAAAATGG + Intergenic
1066953608 10:42145272-42145294 CTGCTGATACCCAGGAAAACAGG - Intergenic
1067197896 10:44138073-44138095 CTGCTGATACCCAGGCAAAAAGG + Intergenic
1067376212 10:45729728-45729750 ATGCTGATATTCAGAAAGTTGGG - Intronic
1067883911 10:50070413-50070435 ATGCTGATATTCAGAAAGTTGGG - Intronic
1068120088 10:52775931-52775953 ATGCTTATAGTCAGATAAAATGG + Intergenic
1068225286 10:54100518-54100540 ATTCTGATACTCAGATAAAATGG + Intronic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1069366643 10:67700495-67700517 CTGCTGATATCCAGCAAACAGGG + Intergenic
1070347900 10:75563803-75563825 CTGCTGATACCCAGGAAAACAGG - Intronic
1071764116 10:88642668-88642690 ATGGTGATATTAAAGAAAGATGG - Intergenic
1072384392 10:94909347-94909369 CTGCTGATACCCAGGAAAACAGG + Intergenic
1072469405 10:95698322-95698344 ATGCTGATATTCAGGAGCAAAGG + Intergenic
1073352541 10:102830242-102830264 ATGCTGAGAAGCAGGTAAAAAGG - Intergenic
1073821649 10:107271253-107271275 TTGCTGAGCTTCAGGTAAAATGG + Intergenic
1074030840 10:109686839-109686861 CTGCTGATACCCAGGAAAACAGG - Intergenic
1075437461 10:122455804-122455826 ATGCTGCCATTTAGGCAAAATGG - Intronic
1075503194 10:122997139-122997161 ATGCTCATAATCAGGAAAATCGG + Intronic
1075898623 10:126019911-126019933 AGGATGATATTCAGGAAGCAGGG - Intronic
1076650814 10:131986008-131986030 ATGCAGATATTTAAGGAAAACGG + Intergenic
1076963315 10:133785237-133785259 ATGCTGATAAGAAGGAGAAAGGG + Intergenic
1077601620 11:3578695-3578717 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1077946507 11:6905441-6905463 CTGCTGATATCCAGGCAAACAGG + Intergenic
1078321688 11:10340447-10340469 CTGGTGATACTCAGGAAAACAGG + Intronic
1079174648 11:18128044-18128066 CTGCTGATACTCAGGCAAACAGG - Intronic
1079332188 11:19542762-19542784 AAACTGAGATTCAGGAAACATGG + Intronic
1079516254 11:21272771-21272793 CTGCTGATACTCAGGCAAAGAGG + Intronic
1079799699 11:24853921-24853943 CTGGTGATATCCAGGCAAAAAGG - Intronic
1079825411 11:25185163-25185185 ATTTTTATATTCAGGAGAAAAGG - Intergenic
1079981651 11:27157525-27157547 CTGCTGATACCCAGGAAAACAGG - Intergenic
1080211856 11:29795330-29795352 CTGCTGATACCCAGGAAAACAGG + Intergenic
1082122145 11:48391162-48391184 CTGCTGATACCCAGGAAAACAGG - Intergenic
1082145154 11:48658013-48658035 CTGCTGATACTCAGGCAAACAGG - Intergenic
1082150260 11:48730125-48730147 CTGCTGATACCCAGGAAAACAGG + Intergenic
1082150671 11:48734841-48734863 CTGCTGATACCCAGGAAAACAGG + Intergenic
1082556128 11:54565404-54565426 CTGCTGATACCCAGGAAAACAGG - Intergenic
1082596234 11:55085230-55085252 CTGCTGATACCCAGGAAAACAGG + Intergenic
1082599655 11:55133567-55133589 CTGCTGATACCCAGGAAAACAGG + Intergenic
1082647672 11:55748286-55748308 CTGCTGATACCCAGGCAAAAAGG + Intergenic
1082905258 11:58300827-58300849 AGGCTGGTGTTCAGGAAAAGAGG + Intergenic
1084257526 11:67953252-67953274 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1085198648 11:74688056-74688078 GGGCTGATATTCAGGAAGGATGG - Intergenic
1086301057 11:85426495-85426517 CTGCTGATACTCAGGCAAACAGG + Intronic
1086615093 11:88807124-88807146 ATGCAGATATAGAGGTAAAAAGG - Intronic
1086757500 11:90582735-90582757 CTGCTGATACCCAGGAAACAGGG - Intergenic
1087072854 11:94099286-94099308 CTGCTGATATCCAGGCAAACAGG - Intronic
1087080057 11:94161992-94162014 ATGCTGATACCCAGGCAAACAGG - Intronic
1087422566 11:97948884-97948906 ATGGTTATATACAGGAAAACAGG + Intergenic
1088559329 11:111096907-111096929 AAGTTCATATTCAGGAAACATGG - Intergenic
1088717261 11:112559754-112559776 ATGCTGATATTCATGTTTAAAGG + Intergenic
1090434220 11:126673481-126673503 ATGCTGATTTTCAGGACCCAAGG + Intronic
1092327136 12:7544453-7544475 CTGGTGATACTCAGGAAACAGGG + Intergenic
1092427755 12:8388048-8388070 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1092429025 12:8395029-8395051 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1093144221 12:15545089-15545111 ATGATGATATTCTAGAAACAAGG + Intronic
1093314158 12:17627800-17627822 CTGCTGATACCCAGGCAAAAAGG - Intergenic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093813980 12:23520928-23520950 CTGCTGATACCCAGGAAAACAGG - Intergenic
1094331719 12:29301428-29301450 AAGCTGTTATTCTGGAAAACTGG - Intronic
1094810632 12:34134188-34134210 CTGCTGATATCCAGGCAAACAGG + Intergenic
1095186691 12:39208566-39208588 CTGGTGATATCCAGGCAAAAAGG + Intergenic
1095195805 12:39315241-39315263 CTGCTGATGATCAGCAAAAATGG + Intronic
1095352987 12:41236777-41236799 GTGCTGAAATTCAGAAAGAATGG - Intronic
1095390420 12:41699518-41699540 ATGCTGGAATTCATAAAAAAAGG + Intergenic
1096225364 12:49863198-49863220 GTGCTTATAGTCAGCAAAAATGG - Intergenic
1096359724 12:50973359-50973381 CTGCTGATACCCAGGCAAAAAGG + Intergenic
1097561247 12:61208865-61208887 CTGCTGATACCCAGGAAAACAGG - Intergenic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099791128 12:87335273-87335295 TTCCTAAAATTCAGGAAAAATGG + Intergenic
1099853144 12:88130259-88130281 TTGATGAAATTCAGGTAAAATGG - Exonic
1100086565 12:90917949-90917971 ATACTGATATGGAGGAGAAAGGG - Intronic
1100851363 12:98715539-98715561 ATGCTGAAATTCAGGTGAGAGGG + Exonic
1101394406 12:104332437-104332459 ATTCTTATAATCAGAAAAAAAGG - Intronic
1101523726 12:105508172-105508194 GTGGTGAGCTTCAGGAAAAACGG - Intergenic
1101797032 12:107984564-107984586 ATGCTGATTTTCAGACATAAAGG + Intergenic
1102947509 12:117002371-117002393 ATGCTCAAATTCAGCACAAAGGG - Intronic
1103690442 12:122768893-122768915 TTGATGTCATTCAGGAAAAATGG + Exonic
1104022439 12:125002306-125002328 ATGCTGGTAGGCAGGTAAAACGG - Intronic
1104472605 12:129042818-129042840 CTGCTGATATCCAGGCAAACAGG - Intergenic
1104474599 12:129061178-129061200 CTGCTGATATGCAGGTAAACAGG - Intergenic
1105420091 13:20244133-20244155 CTGCTGATACCCAGGCAAAAAGG + Intergenic
1105478078 13:20746461-20746483 ATTCTTATCTACAGGAAAAATGG + Intronic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1105546801 13:21356470-21356492 ATGCTGAAATTCATGAAAAGGGG + Intergenic
1108168108 13:47713006-47713028 CTGCTGATACTCAGGCAAACAGG + Intergenic
1108445806 13:50508307-50508329 CTGCTGATACTCAGGCAAACAGG - Intronic
1108858291 13:54822472-54822494 CTGGTGATACCCAGGAAAAAAGG + Intergenic
1109135093 13:58638905-58638927 ATGCTGCTATTCAGGCAAATTGG - Intergenic
1109142233 13:58728280-58728302 ATGCTGATACTTGGTAAAAATGG - Intergenic
1110014193 13:70380026-70380048 ATGCTGCGATTCCGGTAAAAGGG + Intergenic
1110420029 13:75297396-75297418 ATTCTGATTTTCAGAAACAACGG - Intronic
1110703666 13:78579615-78579637 ATGCTGATTTTTAGGTAACATGG + Intergenic
1111576420 13:90160352-90160374 ATTCTGAATTTGAGGAAAAATGG - Intergenic
1111930382 13:94506834-94506856 ATCCTGTTATTCACTAAAAAGGG + Intergenic
1113989743 13:114352073-114352095 ATGCTGATAAGAAGGAGAAAGGG + Intergenic
1114245735 14:20911445-20911467 CTGCTGATACCCAGGAAAACAGG + Intergenic
1114354632 14:21893895-21893917 ATGCTGACATTCAGAAACACAGG + Intergenic
1114354831 14:21896094-21896116 ATCCAGATCTTCAGGAACAAAGG - Intergenic
1115477150 14:33826327-33826349 CTGCTGATACCCAGGCAAAAAGG + Intergenic
1115717618 14:36123701-36123723 CTGCTGATACCCAGGAAAACAGG - Intergenic
1117084907 14:52189837-52189859 ATCTTGTTATCCAGGAAAAAGGG + Intergenic
1117193794 14:53318894-53318916 CTGCTGATATCCAGGCAAACAGG + Intergenic
1117779093 14:59213900-59213922 ATGGTGAAATCCAGGAAAGATGG - Intronic
1118584196 14:67336861-67336883 AAGCTGATATTTAGGAAATCTGG - Intronic
1119970123 14:78961091-78961113 ATGCTGACATTATGGAGAAAAGG + Intronic
1120064820 14:80028439-80028461 CTGCTGATATCCAGGCAAACAGG + Intergenic
1120343163 14:83247205-83247227 ATTATTTTATTCAGGAAAAATGG + Intergenic
1120508420 14:85381980-85382002 ATGCTAATACTCAAGACAAAGGG - Intergenic
1121359563 14:93244162-93244184 AGGCTGATTTTCCCGAAAAAGGG + Intronic
1121672518 14:95723802-95723824 GTGCTAATATTCAGTAAAATGGG + Intergenic
1121897330 14:97660548-97660570 ATGCTGAGATTCAGGAATCCTGG + Intergenic
1123127725 14:105961393-105961415 CTGCTGATACCCAGGAAAATAGG - Intergenic
1202883256 14_KI270722v1_random:81658-81680 CTGCTGATATCCAGGCAAACAGG - Intergenic
1123973333 15:25529076-25529098 AGCTTGATCTTCAGGAAAAATGG + Intergenic
1125180053 15:36872115-36872137 ATGCTGAGAGCCAGGAAAACTGG - Intergenic
1126211505 15:46105386-46105408 CTGCTGATACCCAGGAAAACAGG + Intergenic
1127057222 15:55144033-55144055 CTGCTGATATCCAGGCAAACAGG + Intergenic
1128485830 15:68086914-68086936 AAGCTGTCTTTCAGGAAAAAAGG + Intronic
1129768465 15:78185715-78185737 TTGCTGAAAATCAGCAAAAAAGG + Intronic
1130572882 15:85064456-85064478 ATGCTGATTTTCTTTAAAAAGGG + Intronic
1130761279 15:86822674-86822696 ATGCAGTTTTTCAGGAAAGAAGG + Intronic
1131209496 15:90481531-90481553 ATGCTTGAACTCAGGAAAAAAGG - Intronic
1131680457 15:94716265-94716287 ATGCTGAAACTCAGGAAATGAGG - Intergenic
1132066549 15:98735633-98735655 ATGTGGATATTCAAGAAAGAGGG + Intronic
1133775870 16:8894667-8894689 TTGCTGATATACAGAAATAACGG - Intronic
1136678555 16:31938408-31938430 CTGCTGATACCCAGGCAAAAAGG + Intergenic
1137051830 16:35721099-35721121 CTGCTGATACTCAGGCAAACAGG - Intergenic
1139129482 16:64123825-64123847 AATCTGGTATTCAGGAAAAATGG + Intergenic
1139734165 16:68973034-68973056 CTGCTCATATTCAGGGAAGAAGG + Intronic
1140025015 16:71279695-71279717 ATGCTGATAGTTACGAAAACTGG + Intergenic
1140583091 16:76254581-76254603 CTGCTGATACTAAGGCAAAAAGG - Intergenic
1142453495 16:90200371-90200393 AGGATAATATTCAGGAAATATGG - Intergenic
1143162809 17:4882332-4882354 ATGCTGATTTCCAGGAAGACTGG + Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1144415938 17:15046498-15046520 ATGCTTATATTAAGAAAAACAGG - Intergenic
1145031543 17:19508075-19508097 GTGCTGGAATTCAGGAAAGAGGG + Intronic
1146392544 17:32436336-32436358 ATCCTGAGATTCAGGAAAGCTGG + Intergenic
1148402502 17:47378631-47378653 ATCCTGATAAGCAGCAAAAAGGG - Intronic
1148561494 17:48609345-48609367 ATGCTGATGAGCAGAAAAAATGG + Intronic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1149009282 17:51838268-51838290 ATGCTGAGACTCAGGCAAGATGG - Intronic
1149122461 17:53185891-53185913 ATGTTTATATTTAGGAAAATGGG - Intergenic
1149232602 17:54553190-54553212 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1151413988 17:73949631-73949653 ATGGTGGGATTCAGCAAAAATGG - Intergenic
1151855205 17:76716220-76716242 ATGATGACATACAGGAAGAAGGG + Exonic
1152489857 17:80623334-80623356 TTGCTGATATATAAGAAAAATGG - Intronic
1153499896 18:5737817-5737839 ATGTTGACATTAAGGAGAAATGG - Intergenic
1154127501 18:11704659-11704681 ATACTGATATTAAGGAAGAAAGG - Intronic
1155020035 18:21888219-21888241 CTGCTGATACCCAGGAAAACAGG - Intergenic
1155080622 18:22406668-22406690 CTGGTGATATTCAGGCAAACAGG + Intergenic
1155332909 18:24736241-24736263 ATGCTGAGCTTCAGCAAGAATGG - Intergenic
1156145905 18:34177535-34177557 GTTCTGATATTCAGCAAAAAGGG - Intronic
1156186588 18:34670695-34670717 ATGCTGATACCCAGGCCAAAAGG - Intronic
1156725229 18:40119334-40119356 CTGCTGATACCCAGGCAAAAAGG - Intergenic
1157320850 18:46632722-46632744 ATGCGGATATGCTGGAAAAGCGG + Intronic
1157836407 18:50907342-50907364 GAGCAGTTATTCAGGAAAAATGG - Intronic
1157909198 18:51599230-51599252 AAGTTGAAACTCAGGAAAAACGG - Intergenic
1157942508 18:51944770-51944792 ATGTTGGTATTTAGGAAGAAGGG - Intergenic
1158114404 18:53978985-53979007 CTGCTGATACCCAGGAAAACAGG - Intergenic
1158207947 18:55014547-55014569 TTTCTGATATTGAGGAAAATAGG - Intergenic
1160653686 19:248015-248037 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1161539031 19:4838513-4838535 AGGCTGATATTCAGGGACATCGG + Exonic
1161838488 19:6664300-6664322 TGCCTGATATTCAGGAAGAAGGG - Intronic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1162180557 19:8865944-8865966 ATGCTGCTCTTCTGGAACAAGGG + Exonic
1163140298 19:15343354-15343376 ATGCTGAGATTGGGGAAAATGGG - Intergenic
1163365524 19:16873863-16873885 ATGCTAATTTTTAAGAAAAAGGG - Intronic
1164109836 19:22145799-22145821 GTGTTGTGATTCAGGAAAAAAGG + Intergenic
1164112826 19:22185205-22185227 CTGGTGATACCCAGGAAAAAGGG + Intronic
1164321544 19:24152822-24152844 CTGCTGATACCCAGGCAAAAAGG - Intergenic
1164568445 19:29349203-29349225 CTGCTGATATCCAGGAAAACAGG + Intergenic
1166613893 19:44226037-44226059 CTGCTGATACCCAGGCAAAAAGG - Intronic
1168728450 19:58605686-58605708 ATGCTGATAAGAAGGAGAAAGGG + Intergenic
1202658668 1_KI270708v1_random:48802-48824 CTGCTGATATCCAGGCAAACAGG - Intergenic
925476669 2:4224223-4224245 ATGATGATACACAGGGAAAAAGG - Intergenic
925704976 2:6676007-6676029 ATACTGATATTCTGAAAAAGAGG + Intergenic
927272619 2:21229361-21229383 AGGCTGAAATTCAGAAAACAAGG - Intergenic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
928697514 2:33864208-33864230 AAACTGATATTCTGGAAAGAAGG + Intergenic
928739627 2:34335388-34335410 TTGCTAATATTTAGGAACAAGGG - Intergenic
929481426 2:42312071-42312093 ATGCTAATAAGCAGGAAAACTGG - Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930420393 2:51145455-51145477 ATGCTCATATTGTGGAAAGAGGG + Intergenic
930835897 2:55793386-55793408 CTGCTGATACTCAGGCAAACAGG - Intergenic
930838004 2:55814872-55814894 CTGCTGATACTCAGGCAAACAGG + Intergenic
930974903 2:57445906-57445928 ATGCATGTATTCACGAAAAAAGG + Intergenic
932218308 2:69981522-69981544 ATGTTTATAATCAGGAGAAAAGG + Intergenic
933000678 2:76918676-76918698 AGGCTGTTATTAAGAAAAAAAGG - Intronic
933185594 2:79275535-79275557 TAGATGAAATTCAGGAAAAAAGG + Intronic
933801629 2:85964650-85964672 CTGCTGATACTCAGGCAAACAGG + Intergenic
934027521 2:88013635-88013657 ATGCTGAAATTTATCAAAAAGGG + Intergenic
934550317 2:95257343-95257365 CTGCTGATACTCAGGCAAACAGG - Intronic
934727727 2:96635494-96635516 AAGCTAATATGCAGCAAAAAAGG + Intronic
935162814 2:100543948-100543970 ATGCTGATAGGAAGGGAAAAAGG - Intergenic
935532104 2:104246844-104246866 AGGCTGATATTCAAGAATTAAGG + Intergenic
936570051 2:113605011-113605033 ATGCTGATAAGAAGGACAAAGGG - Intergenic
937160440 2:119756337-119756359 CTGCTGCTATTCAGCAAGAAAGG + Intergenic
937679406 2:124627412-124627434 CTGGTGATATCCAGGAGAAAAGG + Intronic
937833589 2:126448943-126448965 ACTCAGAAATTCAGGAAAAAAGG - Intergenic
938024844 2:127938476-127938498 ATACTGATACTCATGACAAATGG + Intergenic
938442262 2:131346772-131346794 CTGCTGATATCCAGGCAAACAGG - Intronic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
938854557 2:135296850-135296872 CTGCTGATACCCAGGAAAACAGG - Intronic
939137939 2:138319170-138319192 AAGCTGATACTGACGAAAAAGGG + Intergenic
939455842 2:142433879-142433901 ATGCTTATATGCAGGTAAATTGG + Intergenic
939807298 2:146789255-146789277 AGGCTGATACCCAGGCAAAAAGG + Intergenic
939837887 2:147151662-147151684 CTGCTGATACCCAGGAAAACAGG + Intergenic
940067163 2:149643146-149643168 CTGCTGATACCCAGGCAAAAAGG - Intergenic
941094633 2:161223523-161223545 CTTTTGATATTCAGTAAAAATGG - Intronic
941536454 2:166728135-166728157 ATGCTGAGATTGTGGAGAAAAGG + Intergenic
941546217 2:166854563-166854585 CTGCTGATACCCAGGAAAACAGG + Intergenic
942056859 2:172192541-172192563 CTGCTGATATCCAGGCAAACAGG - Intergenic
942358908 2:175150891-175150913 ATGCTGAGATTCAGCAAATTTGG - Intronic
942771441 2:179525709-179525731 AGGCTGATATTCAAGAAGGAAGG - Intronic
943549398 2:189320033-189320055 CTGCTGATATCCAGGCAAACAGG + Intergenic
943834478 2:192501451-192501473 ATGCTCATATTTAGGTATAAGGG - Intergenic
944570101 2:201035875-201035897 CTGCTGATATCCAGGCAAACAGG - Intronic
945258302 2:207820726-207820748 ATGCTTAGATTCAGCAAATAAGG + Intergenic
945348755 2:208751760-208751782 CTGCTGATACCCAGGAAAACAGG - Intronic
945351440 2:208785131-208785153 CTGCTGATACCCAGGAAAACAGG + Intronic
945515947 2:210763292-210763314 ATGCTTAGATGCAGGAACAAAGG - Intergenic
945534008 2:210989521-210989543 ATGCTGATAGCCAAGAAAATGGG + Intergenic
947499862 2:230664147-230664169 ATGCTGTTAGTAAGGAAGAAGGG + Intergenic
949088707 2:242181328-242181350 ATGCTGATAAGAAGGAGAAAGGG + Intergenic
1169701769 20:8454955-8454977 ATCCTTATATTCAAGAAATATGG - Intronic
1170660452 20:18333784-18333806 CTGCTGATATCCAGGCAAACAGG + Intergenic
1170990113 20:21293289-21293311 AAGCAGATATTTAGGAAAAATGG + Intergenic
1171285154 20:23930838-23930860 GTGCTCATATTCAGGAAAACAGG + Intergenic
1171776251 20:29371329-29371351 CTGCTGATACCCAGGAAAACAGG - Intergenic
1171904297 20:30888156-30888178 CTGCTGATAACCAGGAAAACAGG - Intergenic
1174436895 20:50514783-50514805 CTGCCCATATTCAGGAAAATTGG + Intronic
1174728855 20:52894443-52894465 ATGCAGTTACTCAGGAAAGAAGG + Intergenic
1174792540 20:53493876-53493898 AAGCTAATATTCAGGATAATGGG - Exonic
1175743879 20:61439873-61439895 ATGGTGATATTGGGGAAAAAAGG + Intronic
1176127115 20:63480565-63480587 ATGCTGACATTAAGAAAACATGG + Intergenic
1176277952 20:64285000-64285022 ATGCTGATAAGAAGGACAAAGGG + Intronic
1176317108 21:5256826-5256848 CTGCTGATATGCAGGCAAACAGG - Intergenic
1176480403 21:7281099-7281121 CTGCTGATATCCAGGCAAACAGG + Intergenic
1177268161 21:18810516-18810538 ATGCTCAGATTTAGGAACAAAGG - Intergenic
1177565931 21:22819718-22819740 GTTGTGAAATTCAGGAAAAAAGG + Intergenic
1177722624 21:24927839-24927861 GTGCTAATATCCAGGACAAAGGG + Intergenic
1178903640 21:36617389-36617411 CTGCTGATACTCAGGCAAACAGG + Intergenic
1179370381 21:40801267-40801289 ATGCTGATATTTGGGACCAAAGG + Intronic
1179728044 21:43351136-43351158 ATTTTGATAGTGAGGAAAAAAGG - Intergenic
1180263933 21:46697610-46697632 ATGCTGATAAGAAGGACAAAGGG + Intergenic
1180326134 22:11432321-11432343 CTGCTGATATCCAGGCAAACAGG - Intergenic
1180337719 22:11594296-11594318 CTGCTGATAACCAGGAAAACAGG - Intergenic
1180565622 22:16661219-16661241 CTGCTGATACCCAGGAAAACAGG + Intergenic
1182157088 22:28084379-28084401 CTGCTGATACCCAGGAAAACAGG + Intronic
1182162231 22:28134078-28134100 CTGCTGATATCCAGGCAAACAGG + Intronic
1184886677 22:47350792-47350814 CTGCTGATACCCAGGCAAAAGGG - Intergenic
1185036223 22:48478563-48478585 ATGCTGAGAAGCAGAAAAAAAGG + Intergenic
1185430165 22:50805967-50805989 ATGCTGATAAGAAGGACAAAGGG + Intergenic
949647574 3:6114264-6114286 AGGCCCATATTCAGGGAAAAGGG + Intergenic
950682665 3:14595769-14595791 ATGCTGAAGCTCAGGGAAAATGG - Intergenic
951425720 3:22542997-22543019 AAGGTGATATCAAGGAAAAATGG - Intergenic
951474648 3:23092581-23092603 CTGCTGATATCCAGGCAAACAGG - Intergenic
951612041 3:24500718-24500740 ATGCTTATATGCATCAAAAATGG + Intergenic
951666983 3:25137405-25137427 ATGCTGAAATTCAGGACTACTGG + Intergenic
951751526 3:26041897-26041919 CTGCTGATACTCAGGCAAACAGG - Intergenic
951813391 3:26726610-26726632 TTACTGATAATCAGGAATAAAGG - Intergenic
951964668 3:28369429-28369451 CTGCTGATACCCAGGTAAAAAGG - Intronic
952118693 3:30215643-30215665 CTGCTGATACTCAGGCAAACAGG - Intergenic
952119853 3:30229360-30229382 ATGGGGATATTCATGAAATATGG + Intergenic
952174776 3:30850038-30850060 GTCCTGATATTAAGGAAAAGGGG - Exonic
952547149 3:34433010-34433032 ATGCTGATACCCAGGCAAACAGG - Intergenic
952745299 3:36771287-36771309 GGGCTGATAATCTGGAAAAAAGG - Intergenic
953717448 3:45328086-45328108 ATGTTTATCTTCATGAAAAAGGG - Intergenic
954286500 3:49623295-49623317 ATGCTGGCACTCAGGAAACAGGG - Intronic
954734520 3:52694914-52694936 ATACTGATGTTTGGGAAAAATGG - Exonic
955048916 3:55389576-55389598 CTGCTGATATCCAGGCAAACAGG + Intergenic
955100247 3:55841978-55842000 GTTCCCATATTCAGGAAAAAGGG + Intronic
955135543 3:56213872-56213894 CTGCTGATACCCAGGAAAACGGG + Intronic
956038491 3:65120738-65120760 CTGCTGATACCCAGGAAAACAGG + Intergenic
956569747 3:70680946-70680968 CTGCTGATACTCAGGCAAACAGG - Intergenic
956866406 3:73373733-73373755 CTGCTGATACCCAGGAAAATAGG - Intergenic
957111969 3:75973576-75973598 ATGTTCATATTCAGGTAACAGGG - Intronic
957130268 3:76215030-76215052 CTGCTGATACCCAGGAAAACAGG + Intronic
957880974 3:86212637-86212659 ATGATTATATTCAGGAACATAGG - Intergenic
958102791 3:89035351-89035373 ATGCTGATACCCAGGCAAACAGG + Intergenic
958162302 3:89832569-89832591 CTGCTGATACCCAGGAAAATAGG + Intergenic
958166558 3:89884704-89884726 ATGCTGATACACAGGCAAACAGG - Intergenic
958412346 3:93833123-93833145 CTGCTGATACCCAGGAAAACGGG + Intergenic
958520825 3:95184052-95184074 CTGGTGATACTCAGGAAAACAGG - Intergenic
959043717 3:101448478-101448500 CTGCTGATACTCAGGGAAACAGG - Intronic
959723937 3:109522616-109522638 ATGCTGATACCCAGGCAAACAGG + Intergenic
959853694 3:111121993-111122015 ATGTTGAGACTAAGGAAAAATGG + Intronic
959945670 3:112123247-112123269 ATGGTGTTGTTCAGGATAAATGG + Exonic
962278831 3:134035244-134035266 TTGCTGAAATTCACGTAAAATGG - Intronic
962554016 3:136527858-136527880 CTGCTGATACCCAGGAAAACAGG - Intronic
962710603 3:138082454-138082476 AAGCTGATCTTCAGGGTAAAAGG + Intronic
962980494 3:140485229-140485251 CTGCTGATACCCAGGAAAACAGG - Intronic
962995419 3:140623008-140623030 CTGCTGATACCCAGGAAAACAGG + Intergenic
963181001 3:142355952-142355974 ATGCTGAGCTTTAGAAAAAAAGG - Intronic
963825231 3:149945785-149945807 CTGCTGATACCCAGGCAAAAAGG + Intronic
964175703 3:153824199-153824221 ATGCTGATACCCAGGCAAACAGG + Intergenic
964545475 3:157828957-157828979 ATGCTGATAATCAAGACAATGGG - Intergenic
964604390 3:158544196-158544218 AAGCTGATGCTGAGGAAAAATGG + Exonic
964869363 3:161296490-161296512 ACTCTGATATTCTGGAAATAAGG - Intergenic
964988707 3:162777997-162778019 TTGCTGAAACTCAGGAAAACAGG + Intergenic
965711558 3:171560752-171560774 ATACTCATATTTAGTAAAAAAGG - Intergenic
965990361 3:174810776-174810798 GTGCTGATACTCAAGAAAATGGG + Intronic
966484231 3:180449333-180449355 ATGCTGATACCCAGGCAAAGAGG + Intergenic
966493817 3:180557140-180557162 CTGCTGATACTCAGGCAAACAGG + Intergenic
966666296 3:182475098-182475120 CTGCTTATATTAAGGAAATATGG - Intergenic
966984141 3:185164408-185164430 TTCCTGATATTCAGGTACAAAGG + Intergenic
967385059 3:188903091-188903113 ATACATATATGCAGGAAAAAAGG - Intergenic
967461623 3:189754113-189754135 TTGCTGATGTCCAGGCAAAATGG - Intronic
967719758 3:192803320-192803342 ATTCTAATATTCAGGAGATAGGG + Intronic
967845805 3:194041765-194041787 TTTCTGACATTCAGGAAAGAGGG - Intergenic
967874240 3:194255953-194255975 ATGATGAGATTCAGGGAAACTGG - Intergenic
967874699 3:194259912-194259934 AATCTGTTATTAAGGAAAAAGGG - Intergenic
968373117 4:12997-13019 ATGCTGATAAGAAGGACAAAGGG - Intergenic
968416187 4:436228-436250 ATGCTGATAAAAAGGGAAAAAGG + Intronic
969016053 4:4105057-4105079 ATGTTCAGATTCAGGAAACAAGG + Intergenic
969061124 4:4436041-4436063 TTACTGAGATTGAGGAAAAAAGG - Intronic
969159772 4:5246846-5246868 CTGCTGATACCCAGGAAAACGGG - Intronic
969737897 4:9003287-9003309 ATGTTCAGATTCAGGAAACAAGG - Intergenic
970147920 4:13056460-13056482 ATGATGAGAATCAGGGAAAATGG - Intergenic
972373393 4:38448065-38448087 CTGCTGATACCCAGGAAAACAGG - Intergenic
972996049 4:44880312-44880334 CTGCTGATACCCAGGAAAACAGG + Intergenic
973399065 4:49621782-49621804 CTGCTGATAGTCAGGCAAACAGG + Intergenic
973679237 4:53298813-53298835 CTGCTGATACCCAGGCAAAAAGG + Intronic
973693600 4:53467210-53467232 CTGCTGATACTCAGGCAACAGGG + Intronic
973735213 4:53864849-53864871 AGGCTGACATTCAAGAAACAAGG + Intronic
973806758 4:54534210-54534232 CTGCTGATATCCAGGCAAACAGG - Intergenic
974350369 4:60736500-60736522 CTGCTGATATCCAGGCAAACAGG - Intergenic
974560175 4:63506792-63506814 CTGGTGATATCCAGGAAAACAGG + Intergenic
974725204 4:65789882-65789904 ACCCTGAAATTCAGAAAAAATGG + Intergenic
974967032 4:68773488-68773510 ATGCTGATACCCAGGCAAACAGG - Intergenic
975364899 4:73518134-73518156 CTGCTGATACCCAGGAAAACAGG - Intergenic
975426989 4:74241366-74241388 ATAATGATATTGGGGAAAAATGG - Intronic
975524340 4:75332141-75332163 CTGGTGATATTCAGGCAAACAGG + Intergenic
975829964 4:78358889-78358911 CTGATGATATTGAGTAAAAAAGG + Intronic
975875745 4:78834986-78835008 ATGCTAGAATTCAGGAAAATGGG - Intronic
977032159 4:91897816-91897838 ATGCTAATACTAAGGAAAAGAGG + Intergenic
977108598 4:92921620-92921642 TTGCTGATACTCAGGTAAACAGG - Intronic
977110233 4:92943852-92943874 CTGCTGATACTCAGGCAAACAGG - Intronic
977218760 4:94314412-94314434 CTGCTGATACCCAGGCAAAAAGG - Intronic
977524569 4:98128182-98128204 ATGCTGAGATTCAGGGACACAGG - Intronic
977580939 4:98724133-98724155 CTGCTGATACCCAGGAAAACAGG + Intergenic
977630625 4:99238891-99238913 CTGGTGATATTCAGGCAAACAGG - Intergenic
977867576 4:102048175-102048197 TTACTGATGTTCAGGAATAAAGG - Intronic
979658197 4:123221549-123221571 ATGATGATATTCTGGAATATTGG + Intronic
979912201 4:126381625-126381647 CTGCTGATACCCAGGAAAACAGG - Intergenic
980542119 4:134208632-134208654 CTGCTGATATCCAGGCAAACAGG + Intergenic
980607469 4:135111531-135111553 CTGCTGATACCCAGGAAAACAGG - Intergenic
980889159 4:138795732-138795754 ATGCTAATCTTCTGGGAAAAAGG - Intergenic
981441873 4:144792448-144792470 CTGCTGATATCCAGGCAAACAGG + Intergenic
981689585 4:147492403-147492425 ATTCTGATTTTCAGAAAAAAAGG - Intronic
981826605 4:148949522-148949544 ATGCTGATCATTAGGACAAAGGG + Intergenic
981839412 4:149093859-149093881 CTGCTGATACCCAGGAAAACAGG - Intergenic
982479547 4:155892454-155892476 CTGCTGATATCCAGGCAAACAGG + Intronic
982848250 4:160277401-160277423 CTGGTGATATTCAGGCAAACAGG + Intergenic
983066035 4:163211455-163211477 ATGTTCAGATTCAGGAAATACGG - Intergenic
983077304 4:163342679-163342701 ATGCTGAAATCCAGCAGAAAGGG + Intronic
983490273 4:168381247-168381269 ATGCTGATAGTCAAGACAATTGG + Intronic
983947999 4:173608332-173608354 CTGCTGATACCCAGGAAAACAGG - Intergenic
984016748 4:174435751-174435773 AAGGAGATATTCAGGTAAAATGG - Intergenic
984167890 4:176324581-176324603 ATGCAGATATTCTGGAGGAAAGG + Intronic
984361320 4:178737172-178737194 ATCCTTATCTTCAAGAAAAAAGG + Intergenic
984644765 4:182207764-182207786 ATGCCGATTTTCTGGAAAACAGG + Intronic
985204644 4:187522106-187522128 ATGTTCAAATTCAGGAAATACGG + Intergenic
985462275 4:190119567-190119589 ATGCTGATAAGAAGGACAAAGGG + Intergenic
985466538 4:190202535-190202557 ATGCTGATAAGAAGGAGAAAGGG + Intergenic
986663472 5:10079637-10079659 ATGCAGACATTCAGAAATAAAGG + Intergenic
986673469 5:10163618-10163640 AAGATGAGATTCAGGAATAATGG - Intergenic
986869586 5:12031075-12031097 ATGCTGATAGCCAAGAAAATGGG + Intergenic
987475697 5:18389866-18389888 ATTTTGATAGTAAGGAAAAAAGG - Intergenic
988022984 5:25647762-25647784 ATGGTGAGATTCTGGAAAACAGG - Intergenic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
989548270 5:42699923-42699945 ATGCAGATATTCAGAAAGGATGG + Exonic
989616581 5:43342374-43342396 ACGTTGAAATTCAGGAAATACGG + Intergenic
989845158 5:46131752-46131774 CTGCTGATACCCAGGAAAACAGG + Intergenic
989977223 5:50601391-50601413 CTGCTGATACCCAGGAAAACAGG - Intergenic
990071678 5:51790424-51790446 CTGCTGATAGCCAGGAAAATAGG - Intergenic
990084051 5:51952598-51952620 CTGCTGATATCCAGGCAAACAGG + Intergenic
990179261 5:53141927-53141949 CTGCTGATACCCAGGAAAACAGG + Intergenic
991155110 5:63424993-63425015 ATGCTGATAAGGAGGAAAAGAGG - Intergenic
992183570 5:74222082-74222104 CTGCTGATACCCAGGAAAACAGG - Intergenic
993141616 5:84041209-84041231 AAGGTGATGTTCAAGAAAAAAGG - Intronic
993947933 5:94137746-94137768 CTGGTGATATCCAGGCAAAAAGG - Intergenic
994263234 5:97684531-97684553 CTGCTGATACCCAGGAAAACAGG - Intergenic
994266503 5:97723054-97723076 CTGCTGATACCCAGGAAAACAGG - Intergenic
994290480 5:98023464-98023486 CTGCTGATACCCAGGCAAAAAGG + Intergenic
994559165 5:101346061-101346083 ATGCTGGAATTCAGGAATCACGG + Intergenic
994746083 5:103680141-103680163 ACTCTCATATTCAGGAAGAAGGG - Intergenic
996187111 5:120490926-120490948 CTGCTGATATCCAGGCAAACAGG - Intronic
996914862 5:128700355-128700377 ATTCTCACATTCAGGAATAAGGG + Intronic
996964352 5:129290504-129290526 CTGCTGATATCCAGGCAAACAGG - Intergenic
997073512 5:130644741-130644763 ATGCTGAAATTCATGCATAAAGG + Intergenic
997084731 5:130784327-130784349 ATGCTGATACCCAGGCAAACAGG + Intergenic
997405074 5:133639360-133639382 ATGCTGAGATTCAGAAAAGGGGG + Intergenic
997723950 5:136104753-136104775 CTGCTGAAATTCAGGGCAAAAGG - Intergenic
998345173 5:141455822-141455844 ATGCAGATAGACAGGAAAAGGGG - Intronic
998761547 5:145437810-145437832 ATGCTGCTATTAAAGAAATATGG + Intergenic
999080713 5:148840902-148840924 ATGCTAACATTCAGGGAAACAGG + Intergenic
999485382 5:151989760-151989782 CTGCTGATATCCAGGCAAACAGG + Intergenic
999889624 5:155963076-155963098 ATGCTAATATTCAGGGACAAAGG + Intronic
1000544254 5:162578896-162578918 CTGCTGATACTCAGGCAAACAGG + Intergenic
1002377943 5:178801805-178801827 TTGCCCATATTCAGGCAAAATGG + Intergenic
1002754945 6:149542-149564 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1004832851 6:19495876-19495898 CTGCTGATACCCAGGCAAAAAGG + Intergenic
1005202617 6:23364244-23364266 CTGCTGATACCCAGGCAAAAAGG - Intergenic
1005788771 6:29274299-29274321 CTGCTGATACCCAGGAAAACAGG + Intergenic
1007200902 6:40108076-40108098 ATCATTATATTCAAGAAAAATGG - Intergenic
1007354086 6:41297767-41297789 ATGGTGATTTTCAGGGAACAAGG - Intergenic
1007910676 6:45511185-45511207 CTGCTTATATACAGAAAAAAAGG - Intronic
1007977291 6:46114450-46114472 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1008236609 6:49058502-49058524 CTGCTGATACTCAGGCAAACGGG + Intergenic
1008239957 6:49098228-49098250 CTGCTGATACCCAGGAAAACAGG + Intergenic
1008254250 6:49276630-49276652 CTGCTGATACCCAGGAAAACAGG + Intergenic
1008281338 6:49599409-49599431 CTGCTGATACCCAGGAAAACAGG + Intergenic
1008339248 6:50344581-50344603 CTGCTGATACCCAGGAAAACAGG + Intergenic
1008388411 6:50921107-50921129 CTGCTGATACCCAGGAAAACAGG - Intergenic
1008576140 6:52861682-52861704 CTGCTGATACTCAGGCAAACAGG + Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009191478 6:60635061-60635083 CTGCTGATACTCAGGCAAACAGG - Intergenic
1009476357 6:64097025-64097047 CTGCTGATACCCAGGCAAAAAGG - Intronic
1009503689 6:64448724-64448746 CTGCTGATACTCAGGCAAACAGG + Intronic
1009574239 6:65431269-65431291 ATGGTGATATTAAGGAGTAAAGG - Intronic
1009695037 6:67091659-67091681 ATGCTGAAAATTAGAAAAAAAGG + Intergenic
1009823355 6:68834378-68834400 ATGCTGTAATCCAGAAAAAATGG + Intronic
1010049380 6:71484929-71484951 AAGCAGAGAGTCAGGAAAAATGG + Intergenic
1010721311 6:79285526-79285548 CTGCTGATACCCAGGAAAACAGG + Intergenic
1010930791 6:81800389-81800411 ATGCTCAGAATAAGGAAAAAAGG + Intergenic
1011244519 6:85307898-85307920 CTGCTGATACTCAGGCAAAGAGG + Intergenic
1011338084 6:86283406-86283428 CTGCTGATACCCAGGAAAACAGG - Intergenic
1011408191 6:87038463-87038485 CTGCTGATATCCAGGCAAACAGG - Intergenic
1011524159 6:88245184-88245206 CTGCTGATATGCCTGAAAAATGG + Intergenic
1011587475 6:88942293-88942315 ATACTGTCATTCAGAAAAAAAGG - Intronic
1011776692 6:90739059-90739081 TTGGTGATACTCAGGAAAACAGG - Intergenic
1012049919 6:94328521-94328543 CTGCTGGTATTCAGGAACCAAGG - Intergenic
1012118487 6:95334350-95334372 GTGCTGATATTCAAGAAAATGGG - Intergenic
1012184041 6:96191172-96191194 CTGCTGATACCCAGGCAAAAAGG - Intronic
1012459806 6:99447913-99447935 CTGCTGATATCCAGGCAAACAGG + Intronic
1012481829 6:99676075-99676097 CTGCTGATACCCAGGAAAACAGG - Intergenic
1012575680 6:100794798-100794820 AGGGTGTTATTCAGCAAAAATGG - Intronic
1012820102 6:104076215-104076237 ATGCTAATATTCATGTAGAAAGG - Intergenic
1013890922 6:115026272-115026294 ATGAAGAGATTCTGGAAAAAGGG + Intergenic
1013906234 6:115222929-115222951 CTGCTGATACCCAGGCAAAAAGG + Intergenic
1014523772 6:122476625-122476647 ATACATAAATTCAGGAAAAAAGG + Intronic
1014756117 6:125303177-125303199 CTGCTGAGATACAGGAAATAAGG - Intergenic
1015331368 6:131983238-131983260 ATCCTCATATTAAGTAAAAATGG - Intergenic
1016624021 6:146145099-146145121 ATCCCGAAATTCAGGAAAAAAGG + Intronic
1016746309 6:147584148-147584170 ATGCTGATATTCACTAATAAAGG - Intronic
1018567637 6:165172319-165172341 GTGAAGATCTTCAGGAAAAATGG - Intergenic
1019957612 7:4427755-4427777 AAGCAGATATGCAGGAAAACTGG - Intergenic
1020645599 7:10811175-10811197 CTGCTGATATCCAGGCAAACAGG - Intergenic
1020729947 7:11868260-11868282 ATGTTAATATTAGGGAAAAATGG - Intergenic
1021088551 7:16452895-16452917 ATGCTGATAACAGGGAAAAAAGG - Intergenic
1021342207 7:19479306-19479328 CTGGTGATACTCAGGCAAAAAGG - Intergenic
1021592991 7:22284795-22284817 AGGCAGATAGCCAGGAAAAAGGG + Intronic
1022543941 7:31167526-31167548 ATAATGATAATCAGGAAAAAAGG - Intergenic
1022552385 7:31253268-31253290 GTGGTGATAATAAGGAAAAAGGG + Intergenic
1022855340 7:34308862-34308884 AAGCTGAGTTTCAGGAAAGAGGG + Intergenic
1022965783 7:35469988-35470010 ATGCTTTTTTTCAGAAAAAAGGG - Intergenic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1024671413 7:51599276-51599298 CTGCTGATACTCAGGCAAACAGG - Intergenic
1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG + Intronic
1025753980 7:64316363-64316385 GTGCTGATATTGAGGGGAAAAGG + Intronic
1027965132 7:84994598-84994620 ATGCTTAAATTGAGGAAAGAGGG - Intergenic
1028159137 7:87465768-87465790 CTGCTGATACCCAGGAAAACAGG + Intronic
1028200453 7:87955407-87955429 CTGCTGATATCCAGGCAAACAGG - Intronic
1029902869 7:104060494-104060516 ATGTTGAAATGAAGGAAAAAAGG + Intergenic
1030206598 7:106957722-106957744 ATCCAGAAATTCAGGCAAAAAGG - Intergenic
1030318443 7:108140129-108140151 ATGCTGAATTTGTGGAAAAATGG + Intergenic
1030971517 7:116063282-116063304 ATGCAAAGGTTCAGGAAAAAAGG + Intronic
1031083032 7:117276783-117276805 AAGATGACATTCAGGGAAAATGG - Exonic
1031527129 7:122835152-122835174 CTGCTGATACCCAGGCAAAATGG + Intronic
1031571689 7:123367156-123367178 TTGCTGATGCTCAGGAGAAACGG + Intergenic
1031756911 7:125656565-125656587 TTGCTGATGTTCAGAAAAGAAGG + Intergenic
1033107015 7:138536489-138536511 ATGCTGATACCCAGGCAAACAGG - Intronic
1033484467 7:141775214-141775236 ATGCTGATATCCAGGCAAACAGG - Intronic
1033938925 7:146626824-146626846 ATGTTGTTATTCAGGTTAAATGG - Intronic
1034187599 7:149191045-149191067 AAGCCGATTTTCCGGAAAAAGGG - Intergenic
1034723895 7:153317874-153317896 ATGCTGATACCCAGGCAAACAGG - Intergenic
1035513216 8:207810-207832 ATGCTGATAAGAAGGACAAAGGG - Intergenic
1036242988 8:7094568-7094590 ATGTTCAGATTCAGGAAACAAGG - Intergenic
1036257810 8:7219479-7219501 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1036259059 8:7226476-7226498 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1036307564 8:7613035-7613057 ATGTTCAGATTCAGGAAACAAGG - Intergenic
1036309858 8:7678075-7678097 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1036311112 8:7685072-7685094 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1036358415 8:8061036-8061058 ATGTTCAGATTCAGGAAACAAGG - Intergenic
1036359675 8:8068044-8068066 ATGTTCAGATTCAGGAAACAAGG - Intergenic
1036516177 8:9446581-9446603 CTGCTGATACCCAGGAAAACAGG - Intergenic
1036891282 8:12598926-12598948 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1036892539 8:12605916-12605938 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1036898832 8:12656863-12656885 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1036900090 8:12663895-12663917 ATGTTCAGATTCAGGAAACAAGG + Intergenic
1037202534 8:16275698-16275720 ATGCTGAAAATCAAGAAAATTGG + Intronic
1038354256 8:26812451-26812473 ATGCTTATTTACAGGAAACAGGG + Intronic
1038355416 8:26824617-26824639 ATGCTGGCATTGAGCAAAAAGGG - Intronic
1038378058 8:27063118-27063140 CTGCTGATACCCAGGAAAACAGG - Intergenic
1038870526 8:31489085-31489107 CTGCTGATATCCAGGCAAACAGG - Intergenic
1038877444 8:31566961-31566983 CTGCTGATACCCAGGAAAACAGG + Intergenic
1039917329 8:41869800-41869822 AAGCTGATGTTCAGTCAAAATGG + Intronic
1040273561 8:45985295-45985317 TTGCTGATATCCAGGCAAACAGG - Intergenic
1040428852 8:47317815-47317837 CTGCTGATACTCAGGGAAACAGG + Intronic
1040446883 8:47504905-47504927 CTGCTGATATCCAGGCAAACAGG - Intronic
1040493209 8:47943663-47943685 ATGCTGATACTCAGGTTACATGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041286266 8:56265581-56265603 CTGCTGATACCCAGGAAAACAGG - Intergenic
1041412009 8:57566681-57566703 ATGCTGATATAGTGTAAAAAAGG + Intergenic
1042015426 8:64303901-64303923 AACATGATATTCAGGACAAAAGG - Intergenic
1042604589 8:70532863-70532885 ATGCTGTTATACAGGAAATGTGG + Intergenic
1042765953 8:72321878-72321900 CTGCTGATATTCAGGCAAACAGG + Intergenic
1042800619 8:72713528-72713550 CTGCTGATACCCAGGAAAACAGG + Intronic
1043129326 8:76441713-76441735 ATGGTGATACTCAGGCAAACAGG - Intergenic
1044189605 8:89299446-89299468 ATGCTTATATTGGGGAAAAAGGG + Intergenic
1045241167 8:100402664-100402686 CTGCTGATACCCAGGAAAACAGG + Intronic
1045511634 8:102816213-102816235 ATGAAGATGTTGAGGAAAAAAGG + Intergenic
1045880284 8:107030365-107030387 GTGCTGATAGTCAAGAAAATAGG + Intergenic
1045979403 8:108167114-108167136 CTGCTGATACCCAGGAAAACAGG + Intergenic
1046501298 8:115080900-115080922 CTGCTGATAATCAGAAAAATTGG + Intergenic
1047228745 8:122978189-122978211 ATGCTGATATTCATAAAAAGGGG - Intergenic
1047804252 8:128342907-128342929 TTGCTGATATTCATGAAGACTGG + Intergenic
1048344460 8:133566296-133566318 AGGCTGATTTTAAGGTAAAATGG - Intronic
1048461252 8:134623483-134623505 ATGCAGATTTGGAGGAAAAAGGG - Intronic
1048819818 8:138370279-138370301 ATGCTGTTGTTCAGGATGAATGG + Intronic
1048843228 8:138582918-138582940 ATCCTGATGTTTGGGAAAAAAGG - Intergenic
1049996006 9:1034645-1034667 ATGCTAATATTTAAGAAGAAGGG - Intergenic
1050012060 9:1195393-1195415 CTGCTGATACCCAGGAAAACAGG - Intergenic
1050243539 9:3662628-3662650 ATGATGATATTAGGGAAAGAGGG - Intergenic
1050645387 9:7713744-7713766 CTGGTGATACCCAGGAAAAAGGG + Intergenic
1051089017 9:13384920-13384942 ATGTTAATATTCAAGAAAATGGG + Intergenic
1051204937 9:14677166-14677188 ATGTTTACATCCAGGAAAAATGG - Intronic
1051879327 9:21824375-21824397 CTGCTGATATCCAGGCAAACAGG - Intronic
1051960399 9:22753968-22753990 ATTCAGATACTCAGGAAGAAAGG + Intergenic
1052145640 9:25045248-25045270 CTGCTGATATCCAGGCAAACAGG - Intergenic
1052328263 9:27240224-27240246 CTGCTGATATTCAGGCAAACAGG + Intergenic
1052560924 9:30081824-30081846 ATACTAATATTCAGGTAAGATGG - Intergenic
1053598337 9:39585755-39585777 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1053856370 9:42342764-42342786 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1054894412 9:70292034-70292056 AAGCTGTTATTCAAGAAAAATGG - Intronic
1055346543 9:75345838-75345860 CTGCTGATACTCAGGCAAACAGG - Intergenic
1055853877 9:80663452-80663474 CTGCTGATACTCAGGCAAACAGG - Intergenic
1055904917 9:81282027-81282049 TTTCTGAGATTCTGGAAAAATGG - Intergenic
1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG + Intergenic
1056302540 9:85257450-85257472 CTGTTGATATTCAGGCAAACAGG - Intergenic
1056758683 9:89399093-89399115 ATCCTGATACTCAGGAATAGAGG + Intronic
1056987846 9:91380677-91380699 ATGCTGTTATTCAAAAAAGAAGG + Intergenic
1057324639 9:94050487-94050509 CTGCTGATATCCAGGCAAACAGG - Intronic
1058335549 9:103823846-103823868 ATGCAGTTATTTGGGAAAAATGG + Intergenic
1058336187 9:103832386-103832408 ATACTAGTGTTCAGGAAAAAAGG + Intergenic
1059143906 9:111880055-111880077 AAGCTTTTATTCAAGAAAAATGG + Intergenic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1059618574 9:115977907-115977929 AGCCTGAGATTCAGGAAATATGG - Intergenic
1060319634 9:122544947-122544969 ATGCTTGAATTAAGGAAAAAAGG - Intergenic
1060905379 9:127300141-127300163 TTGATGTTATTCAGGAAAACTGG - Intronic
1203370829 Un_KI270442v1:302845-302867 CTGCTGATACCCAGGAAAACAGG + Intergenic
1203415372 Un_KI270582v1:1874-1896 CTGCTGATATGCAGGCAAACAGG - Intergenic
1185823882 X:3230486-3230508 TTGGAGATATTCAGGAAAACAGG + Intergenic
1186483377 X:9913206-9913228 ATGCGGACATTGAGAAAAAATGG + Intronic
1187267178 X:17746264-17746286 ATGTTGCTATTCAGGAAATGTGG - Intronic
1187287493 X:17919565-17919587 ATCCTCATATTCAGAAAAAAAGG + Intergenic
1188230967 X:27662369-27662391 ATGGTAATATTTAGAAAAAATGG - Intronic
1191117887 X:56869850-56869872 CTGCTGATACTCAGGTAAACAGG + Intergenic
1191628158 X:63291204-63291226 CTGCTGATATCCAGGCAAACAGG - Intergenic
1191647054 X:63492959-63492981 CTGCTGATAACCAGGAAAACAGG + Intergenic
1191669781 X:63738545-63738567 ATGCGGTGCTTCAGGAAAAATGG - Intronic
1191704862 X:64084132-64084154 CTGCTGATACCCAGGAAAACAGG - Intergenic
1191754068 X:64575250-64575272 CTGCTGATACTCAGGCAAACAGG + Intergenic
1191859310 X:65652988-65653010 ATTCTGATACTCAGAATAAATGG + Intronic
1192603956 X:72494125-72494147 ATTCAGATATTCAGTGAAAATGG + Intronic
1192755078 X:74039210-74039232 CTGCTGATATCCAGGCAAACAGG - Intergenic
1192918965 X:75685663-75685685 CTGCTGATATTCATGCAAACAGG - Intergenic
1192931358 X:75810072-75810094 CTGCTGATACGCAGGAAAACAGG - Intergenic
1192956400 X:76075198-76075220 AGTCTGACATGCAGGAAAAAAGG + Intergenic
1193007639 X:76638521-76638543 CTGCTGATACCCAGGAAAACAGG - Intergenic
1193017901 X:76756429-76756451 ATGCTGATACCCAGGGAAACAGG + Intergenic
1193060061 X:77196757-77196779 CTGGTGATATCCAGGAAACAGGG - Intergenic
1193138114 X:77995614-77995636 ATACAGATAGTCAGGATAAAAGG - Intronic
1193772696 X:85606075-85606097 ATACTTATATCCAGGAAAATGGG - Intergenic
1194292356 X:92089973-92089995 ATGATCATCTTGAGGAAAAATGG - Intronic
1194370123 X:93061036-93061058 CTGCTGATACCCAGGAAAACAGG + Intergenic
1194546602 X:95242485-95242507 ATGAAGATATTCAGTACAAATGG + Intergenic
1194826784 X:98574972-98574994 ATGCTGATAAGAAGGGAAAAAGG - Intergenic
1194827675 X:98582504-98582526 ATGCTGATAAGAAGGGAAAAAGG - Intergenic
1195126194 X:101812167-101812189 CTGCTGATACTCAGGCAAACAGG - Intergenic
1195556197 X:106227802-106227824 ATGCACATATTCATGAAATAAGG + Intergenic
1195806518 X:108776992-108777014 TTGCTCATAATCAGGGAAAACGG - Intergenic
1195952272 X:110287512-110287534 ATGGTGATACTCAGGAAACCAGG - Intronic
1196113640 X:111974133-111974155 ATGGTGATTTTCAGGACACAGGG + Intronic
1196312478 X:114184321-114184343 CTGGTGATACTCAGGAAAATAGG + Intergenic
1196621781 X:117832711-117832733 CTGCTGATACCCAGGAAAACAGG - Intergenic
1197268308 X:124399599-124399621 ATGCTCATATACAGGTGAAATGG + Intronic
1197847141 X:130814583-130814605 CTGGTGATACTCAGGCAAAAAGG + Intronic
1198076474 X:133198067-133198089 ATGAGGATATGCAGGAAGAAGGG + Intergenic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1199309542 X:146307175-146307197 ATGCTAATCAGCAGGAAAAATGG + Intergenic
1199466922 X:148148442-148148464 ATGCTCATATTCAAGAAGAGAGG - Intergenic
1199486299 X:148352172-148352194 ATGCTGATACCCAGGCAAAGAGG - Intergenic
1200609864 Y:5314599-5314621 ATGATCATCTTGAGGAAAAATGG - Intronic
1201466149 Y:14283019-14283041 CTGCTGATACCCAGGAAAACTGG + Intergenic
1201494203 Y:14575862-14575884 CTGCTGATACTCAGGCAAACAGG - Intronic
1201519949 Y:14861954-14861976 CTGCTGATAATCAGGCAAACAGG + Intergenic
1201522172 Y:14887803-14887825 CAGCTGATATCCAGGAAAACAGG - Intergenic
1201690855 Y:16762908-16762930 CTGCTGATACCCAGGAAAACAGG + Intergenic
1201795848 Y:17895472-17895494 CTGCTGATACCCAGGAAAACAGG + Intergenic
1201805707 Y:18010513-18010535 CTGCTGATACCCAGGAAAACAGG - Intergenic
1201920840 Y:19232090-19232112 CTGCTGATACCCAGGAAAAGAGG - Intergenic
1201926121 Y:19289937-19289959 ATGTTGAAATTCAGAAAACATGG + Intergenic
1201956850 Y:19634132-19634154 CTGCTGATACCCAGGAAAATAGG - Intergenic
1202022307 Y:20478012-20478034 CTGCTGATACTCAGGCAAACAGG + Intergenic
1202166521 Y:21995401-21995423 CTGCTGATATTCAGGCCAACAGG - Intergenic
1202224837 Y:22590972-22590994 CTGCTGATATTCAGGCCAACAGG + Intergenic
1202318277 Y:23604688-23604710 CTGCTGATATTCAGGCCAACAGG - Intergenic
1202552490 Y:26065369-26065391 CTGCTGATATTCAGGCCAACAGG + Intergenic