ID: 921372981

View in Genome Browser
Species Human (GRCh38)
Location 1:214444619-214444641
Sequence GCAGATTGCAGGAGTCTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921372981 Original CRISPR GCAGATTGCAGGAGTCTAAG GGG Intronic
901462646 1:9400798-9400820 GCAGCCTGCAGGAGCCTCAGAGG - Intergenic
901857534 1:12054014-12054036 GCAGATGGCAGGGGTCTCAAGGG - Intergenic
902720462 1:18300863-18300885 GCAGATTCCTGCAGTCTGAGCGG - Intronic
904744241 1:32701674-32701696 GCAGATGACAGGAGGCTCAGAGG + Intronic
906226460 1:44126345-44126367 GCAGCTTGCAGGAGCCAGAGTGG - Intronic
906280258 1:44548447-44548469 GCTGAATGAAGGAGTCTAGGTGG - Intronic
906529459 1:46515157-46515179 GCAGATTCCAGGAGTGACAGAGG + Intergenic
906662873 1:47594842-47594864 GCAGCTGGCAGGAGCCGAAGTGG + Intergenic
907106162 1:51884726-51884748 GAAGATTGCTTGAGTCTAGGAGG - Intergenic
911304648 1:96218116-96218138 GCATATTGCAGTAAACTAAGAGG - Intergenic
911602428 1:99860958-99860980 GCAGAATTCAGGATTCTAACAGG - Intronic
912160533 1:106979123-106979145 CCATATTGCAGGGCTCTAAGTGG - Intergenic
918250584 1:182699731-182699753 GCACATTGCAGGCCTCTCAGGGG - Intergenic
918579355 1:186107846-186107868 GCATATTGGACGAGTCTAACTGG - Intronic
918660691 1:187084236-187084258 GCAAATTGCAGAATTGTAAGAGG - Intergenic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
922052419 1:222006261-222006283 GAAGATTGCTGGAGCCCAAGAGG - Intergenic
922531373 1:226347711-226347733 GCAGATTGCCTGAGGCTGAGAGG + Intergenic
1063581642 10:7313405-7313427 GCAGATTGCTTGAGCCTAGGAGG - Intronic
1064259744 10:13775717-13775739 GGAGGTTGGAGGAGTCTAAGAGG + Intronic
1065051243 10:21793861-21793883 GCAGATTGCTTGAGCCTAGGAGG + Intronic
1065302021 10:24331419-24331441 GCAGATTTCAGGTGTTGAAGAGG + Intronic
1067046282 10:42987037-42987059 GCAGCCTGCAGGAGGCTCAGCGG - Intergenic
1075709246 10:124521900-124521922 GCAGCTGTCAGGAGTCTGAGAGG + Intronic
1076163319 10:128262739-128262761 GAAGATTGCTGGAGTCCAGGAGG + Intergenic
1077577904 11:3398362-3398384 GCAGCTTGCAGGAGCCACAGTGG + Intergenic
1077611043 11:3643138-3643160 GGAGATAGCAGGATTCTAGGTGG - Intergenic
1079197601 11:18343921-18343943 GCAGATTGCTTGAGCCCAAGAGG - Intronic
1079695117 11:23472770-23472792 GCAGATTGCAGAATTTTTAGAGG - Intergenic
1080432050 11:32208467-32208489 GCAGATTTGAGGAGTCTGTGGGG - Intergenic
1080527113 11:33133837-33133859 CCACATTGAAGGAGACTAAGAGG + Intronic
1082682469 11:56193068-56193090 GGAGCTTGCAGGAGTGGAAGTGG - Intergenic
1084231849 11:67759263-67759285 GCAGCTTGCAGGAGCCACAGTGG + Intergenic
1084487870 11:69461623-69461645 GCAGATTGCCAGAGTCCCAGAGG + Intergenic
1085039552 11:73318758-73318780 GCTGATTGCAGAGGTCTAGGTGG + Intronic
1085639842 11:78186704-78186726 CCAAATTGCAGAAGTCGAAGAGG - Intronic
1088688063 11:112301324-112301346 GCAGATTATAGGAGACTAAGGGG - Intergenic
1089229991 11:116965498-116965520 ACAAATTGCAGAAGTTTAAGAGG + Intronic
1092014837 12:5149876-5149898 GCAGATTCCAGGGTTCTCAGTGG + Intergenic
1092073407 12:5652557-5652579 ACAGCTTCGAGGAGTCTAAGGGG - Intronic
1097029657 12:56081599-56081621 GAAGATTGCAGGAGTCTGGATGG - Intronic
1098134258 12:67384983-67385005 GGAGATAAGAGGAGTCTAAGAGG - Intergenic
1102531655 12:113551113-113551135 GCTGATGGCAGGACTCTGAGAGG + Intergenic
1106740310 13:32634110-32634132 GAAGACTGCAGGAATCTATGAGG - Intronic
1110223470 13:73096246-73096268 GCAGATTGCAGGAGCCTTGGAGG + Intergenic
1111916285 13:94364220-94364242 GCAGCTTGTAGGAGACTAAGAGG + Intronic
1112089428 13:96067443-96067465 GATGATTGCATAAGTCTAAGTGG + Intergenic
1116364339 14:44040961-44040983 GCAGATTGCAGGAATAGAGGAGG + Intergenic
1116553246 14:46269489-46269511 CCGGATTGCAGGAGGCTAAAAGG - Intergenic
1116963268 14:50988851-50988873 TTAGATTTCAGGAGTCTTAGAGG + Intronic
1118428978 14:65696314-65696336 GCAGAATGCAGAATTCTAAATGG + Intronic
1122759268 14:104009458-104009480 GCAGATTGCAGGACTGGAAGTGG + Intronic
1125579438 15:40775209-40775231 CCAGATTGCAGGAGCCTTGGAGG - Intronic
1131721117 15:95169989-95170011 CGAGCTTGCAGGAGTCTGAGTGG - Intergenic
1133951471 16:10397765-10397787 GAAGATTGCATGAGCCTGAGAGG + Intronic
1134912262 16:18038263-18038285 GCAGATTACAGAAGTCTGAGGGG + Intergenic
1135789080 16:25376885-25376907 ACAGCTTACAGGAGTCTAAGGGG - Intergenic
1141407008 16:83803444-83803466 GAGGATTGCTGGAGTCTGAGAGG + Intergenic
1142040692 16:87891912-87891934 GCAGAGTGGAGGGGTCGAAGGGG + Exonic
1143043117 17:4054401-4054423 GGAAATTGCAGGAGGCTTAGAGG + Intronic
1143305328 17:5941941-5941963 GAAGATTTCAGGAGTTTAAGGGG + Intronic
1145224154 17:21114008-21114030 GCAGATGGCAAGAGTGCAAGAGG - Intergenic
1147175196 17:38651490-38651512 GCAGATTGCTTGAGCCTGAGAGG - Intergenic
1147199013 17:38787123-38787145 GCAGATTGCTTGAGTCCAGGAGG - Intronic
1150335629 17:64328523-64328545 TCTGATTTCAGGAGTCTGAGTGG + Intronic
1151491888 17:74436740-74436762 GCAGGTGTCCGGAGTCTAAGTGG + Intronic
1152652479 17:81501510-81501532 GCAGATTGCTGGAGTCAGGGAGG + Intergenic
1158573763 18:58618778-58618800 GCAGATTGCAGGGGTGCAGGGGG - Intronic
1162488338 19:10976077-10976099 CCCCATTGCAGGACTCTAAGCGG + Intronic
1163525594 19:17819142-17819164 GCAGATTGCTTGAGTCTGGGAGG + Intronic
1163702409 19:18792671-18792693 ACTGATTGCAGGAGGTTAAGGGG - Intergenic
1165193852 19:34085917-34085939 GCAGATTGCTTGAGCCTAGGAGG - Intergenic
1165568473 19:36754077-36754099 GCAGATTGCTTGAGCCTAGGGGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1166822422 19:45588627-45588649 GGTGACTGCAGGAGTCCAAGAGG - Intronic
1168077174 19:53987424-53987446 GTAGACTTCAGGAGTCAAAGGGG + Exonic
1168473863 19:56662190-56662212 GGAGGTGGCAGGAGTCTGAGAGG - Exonic
925988845 2:9237499-9237521 GAAGATTGCTGGAGCCTAGGAGG - Intronic
929063766 2:37951022-37951044 AAAGAATGCGGGAGTCTAAGAGG - Intronic
929736552 2:44555949-44555971 CCAGATTGCAGTGGGCTAAGGGG + Intronic
930773558 2:55151155-55151177 GCAGATGGGAGGAGTCTTATAGG - Intergenic
932267088 2:70377149-70377171 GCAGATAGTGGGAGTCTAAGAGG + Intergenic
936285030 2:111175064-111175086 CCAGATTACAGGAGACCAAGGGG + Intergenic
937113221 2:119383591-119383613 GCAGATGGCAGAAGTTCAAGAGG - Intergenic
937247235 2:120501671-120501693 GCAGATTCCAGGAGTTTCAGGGG - Intergenic
940072262 2:149701903-149701925 GCATATCGCAGGAGTCAAGGAGG - Intergenic
941224546 2:162830759-162830781 GCAGAATGCAGAAGGCTAAAAGG - Intronic
941838483 2:170053037-170053059 GTAGATTGCAGGGGGCTGAGAGG + Intronic
944843597 2:203646655-203646677 GCAGACTGCAGGACTACAAGAGG - Intergenic
946285025 2:218696487-218696509 GAAGAATGCAGGTGCCTAAGAGG - Intronic
947825991 2:233106381-233106403 GCAGATTGCAGGGGCCCAGGAGG + Intronic
947891012 2:233620272-233620294 GCAAGTTGCAGGACTCTAAGAGG + Intronic
947892615 2:233638902-233638924 GCAAGTTGCAGGACTCTAAGAGG + Intronic
947896113 2:233674329-233674351 GCAAATGGCAGAAATCTAAGAGG + Intronic
948650304 2:239439700-239439722 GCAGAGTGCCGGAGGCCAAGGGG - Intergenic
1169392791 20:5203922-5203944 GTAGATTCCAGGAGCCTTAGAGG + Intergenic
1170611465 20:17917145-17917167 GAAGATTGCTTGAGTCTGAGGGG + Intergenic
1171433600 20:25102942-25102964 GCACATTGCAGGAGTGCAGGAGG + Intergenic
1174197106 20:48781107-48781129 ACAGATTACAGGAGACTAAGGGG + Intronic
1174608158 20:51776409-51776431 GCAGATTGCATGAGCCTAGGAGG + Intergenic
1175693847 20:61086373-61086395 GCAGATTGCTTGAGCCTAGGAGG - Intergenic
1176031181 20:63012932-63012954 GCAGATTGCTGGAGGCTGTGTGG - Intergenic
1178816750 21:35937278-35937300 ACAGATTGGAGAAGACTAAGGGG + Intronic
951447821 3:22802587-22802609 GAAGAATGCAGAAGTCTCAGGGG + Intergenic
957048481 3:75394566-75394588 GCAGCTTGCAGGAGCCACAGCGG + Intergenic
957824746 3:85426229-85426251 GGAGATTGCTTGAGCCTAAGAGG - Intronic
958580860 3:96020359-96020381 TGAGATTTCAGGAATCTAAGAGG - Intergenic
959025987 3:101240205-101240227 GAAGATTGCTGGAGTCTAGGAGG - Intronic
960144541 3:114186595-114186617 GCAGCTTGCAGGAGCCAGAGTGG - Intronic
960377199 3:116917784-116917806 GCAGATTGCCTGAGTCCAGGAGG + Intronic
961756297 3:129129021-129129043 CCAGATCCCAGGAGTCTAGGTGG - Intronic
961792459 3:129385984-129386006 TCAGATTACTGGAGTCTGAGAGG - Intergenic
961806429 3:129492550-129492572 TCAGATTACTGGAGTCTGAGAGG - Intronic
961880562 3:130058679-130058701 GCAGCTTGCAGGAGCCAGAGTGG + Intergenic
962672679 3:137725405-137725427 GCAGATGGCAGAAGTTCAAGAGG - Intergenic
963190481 3:142465914-142465936 GCAAATTGCTTGAGCCTAAGAGG + Intronic
964407615 3:156365898-156365920 TCAGACTGCAGAAGTCTAAGAGG + Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967862523 3:194162599-194162621 GCACATTTTAAGAGTCTAAGAGG - Intergenic
967983797 3:195080764-195080786 GCGGATTGATGGAGTCTAACTGG - Intronic
968750595 4:2387040-2387062 GCAGACTGCAGGAGACTCCGGGG + Intronic
968992955 4:3927023-3927045 GCAGCTTGCAGGAGCCACAGTGG + Intergenic
969188489 4:5498014-5498036 TCACTTTGCAGGAGGCTAAGGGG - Intronic
969822520 4:9731338-9731360 GCAGCTTGCAGGAGCCACAGTGG - Intergenic
969930699 4:10628068-10628090 ACAGATTGGAGGAGGCCAAGAGG - Intronic
971847298 4:31935921-31935943 GCATATTTCAATAGTCTAAGTGG - Intergenic
972690404 4:41391765-41391787 ACAGATTGATGGAGACTAAGGGG + Intronic
974672325 4:65048322-65048344 GCATTTTGAAGGAGTATAAGAGG - Intergenic
975210739 4:71697072-71697094 GCAGATTGCTTGAGCCTAAGAGG - Intergenic
979888185 4:126058741-126058763 GCAGAGTGCAGCAGTCTACTGGG + Intergenic
980462859 4:133139411-133139433 CCAGAATGCAAGAGTTTAAGTGG - Intergenic
981974798 4:150713024-150713046 GCAGATTGCTTGAGTCCAGGTGG - Intronic
982466223 4:155736109-155736131 ACAGATTGCAGGAATCTAAAAGG - Intergenic
986062102 5:4201571-4201593 GCAGGCTGCAGGGGTCTAAAGGG - Intergenic
987052783 5:14161941-14161963 GCAGATGGCTGGAGTCCAGGAGG - Intronic
988499919 5:31776088-31776110 TCAGATTCCTGGAGTGTAAGAGG + Intronic
990733097 5:58830963-58830985 GAAGATTGCTTGAGTCCAAGAGG - Intronic
990786073 5:59421684-59421706 GCAGTTAGTAGGAGTCTAAAGGG + Intronic
991143521 5:63274115-63274137 GCTGAATCCAGGAGGCTAAGCGG - Intergenic
992280240 5:75167576-75167598 GCAGATTGGAGGATTGCAAGAGG + Intronic
996519788 5:124413973-124413995 GCAGTTTGCAGAAGCCTCAGAGG - Intergenic
997720591 5:136075535-136075557 GCAGAGTGCAAGTGTCTTAGAGG + Intergenic
998697351 5:144655433-144655455 GCAGATGGCAAGAGTGTAATGGG - Intergenic
999260931 5:150238651-150238673 GCTGGTTCCAGAAGTCTAAGGGG + Intronic
1000808387 5:165827230-165827252 GCAGCTTGCGGGAGTCAGAGTGG - Intergenic
1002009719 5:176268564-176268586 GAAGATTTCTGGAGACTAAGAGG + Intronic
1002217002 5:177643728-177643750 GAAGATTTCTGGAGACTAAGAGG - Intergenic
1004940249 6:20549129-20549151 ACAGATTGGAGGAAACTAAGGGG - Intronic
1005212190 6:23479416-23479438 ACAGATTGCAGAAGACTAAGGGG + Intergenic
1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG + Intronic
1007622468 6:43223415-43223437 GCAGAATGCAGGAGCAGAAGGGG - Intronic
1008905495 6:56673153-56673175 GCAGATCGCCTGAGTCTAGGAGG + Intronic
1011872462 6:91913064-91913086 GTAGATTGAAGGAGACAAAGAGG + Intergenic
1012346389 6:98192571-98192593 GTACATTGCAGGAGTTTAATAGG + Intergenic
1014093853 6:117438296-117438318 GCAGCTTGCAGGACTGAAAGTGG - Intronic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1015697220 6:135993982-135994004 ACAGCTTGCAGAAATCTAAGAGG + Intronic
1017026425 6:150185345-150185367 GCAGATTGCAGGAGCCTTGCAGG - Intronic
1019288037 7:233495-233517 CCAGAGTGCAGGGGTCTAAAAGG + Intronic
1019743343 7:2686442-2686464 GAGGATTGCTGGAGTCTAGGAGG + Intronic
1022032959 7:26508659-26508681 GCAGGTGGCAGGAGTCTCTGTGG - Intergenic
1025742601 7:64210669-64210691 GAAGATTGCTGGAGTCTGATAGG + Intronic
1025872616 7:65449115-65449137 GCAGATTGTAGGATTTTAATAGG + Intergenic
1026562609 7:71462960-71462982 GCAGATTGCAGCAGACAAAAAGG + Intronic
1032405704 7:131653815-131653837 GTAGATACCAGGAGACTAAGGGG + Intergenic
1033166069 7:139039715-139039737 GAGGATTGCTTGAGTCTAAGAGG + Intergenic
1033652345 7:143352592-143352614 GCAGATTGCAGGAGTGCACATGG - Intergenic
1034263024 7:149768872-149768894 GTAGATGGCAGGAGTCAGAGAGG - Intronic
1034454478 7:151159472-151159494 GAGGATTGCTGGAGTCTGAGAGG - Intronic
1035330690 7:158095147-158095169 GCTGATTGCAGGAGGCTTTGGGG - Intronic
1035626558 8:1075411-1075433 GCCCATTGCAGGAGACAAAGGGG - Intergenic
1036171002 8:6484713-6484735 GCAGCTTGCATGACTCTCAGGGG + Intronic
1038219826 8:25596889-25596911 CCTGATTGCAGGTGTCTAAGGGG + Intergenic
1038418233 8:27413440-27413462 CCAGATTGGAGGAGACTAAAGGG - Intronic
1043545674 8:81313028-81313050 GCAGATCACAGGGGTCCAAGTGG - Intergenic
1044058091 8:87597848-87597870 GCAGATTGCTTGAACCTAAGAGG - Intronic
1045332082 8:101163996-101164018 GCAGATGGCAGAAGTGCAAGAGG - Intergenic
1049033971 8:140060470-140060492 GCAGAGTGCAGGAGGCCAAGGGG - Intronic
1052844656 9:33324459-33324481 GAAGATTGCTTGAGTCCAAGAGG + Intronic
1055286039 9:74728869-74728891 GCAGTTTGCAGGAGAGCAAGTGG - Intronic
1059367691 9:113799571-113799593 GCTGATTTCAGGAGGCAAAGGGG - Intergenic
1060196101 9:121624286-121624308 GCAGCTTGTAGGAGTCACAGAGG + Intronic
1062714198 9:137997286-137997308 GCAGATTACAGTAGTATCAGGGG + Intronic
1185771443 X:2768192-2768214 ACAGATTGGAGGAGATTAAGTGG + Intronic
1186660693 X:11665234-11665256 GGAGCTTGCTGGAGTCTTAGAGG - Exonic
1187387566 X:18862393-18862415 GCAAAATGGAGGAGTTTAAGTGG + Intergenic
1190143913 X:47873394-47873416 GCAGATTGAGGGAGTTTCAGGGG - Intronic
1192017489 X:67347131-67347153 GAAGATGGCAGGAGAGTAAGAGG + Intergenic
1192533391 X:71908784-71908806 GCAGATTGAAGGAGACTGTGTGG - Intergenic
1197443297 X:126516133-126516155 GCAGAATGCAGGAGTAAAAATGG + Intergenic
1198160599 X:134004072-134004094 GCAGATTGTAGGATTTTAATAGG - Intergenic
1200242371 X:154504040-154504062 GCAGATTGCTGCAGTCCAGGAGG - Intergenic
1200876891 Y:8165749-8165771 CCAGATTGCAGGAGAGAAAGAGG + Intergenic
1200961855 Y:9003192-9003214 GCACTTTGCAGGAGTCTTTGGGG + Intergenic
1200982378 Y:9273894-9273916 GCAGATAGGAGGAGTAGAAGGGG + Intergenic
1202115637 Y:21467316-21467338 GCAGATTGCAGCAGTCGCCGTGG + Intergenic
1202128371 Y:21588417-21588439 GCACTTTGCAGGAGTCTTTGGGG + Intergenic
1202150921 Y:21843040-21843062 GCACTTTGCAGGAGTCTTTGGGG - Intergenic