ID: 921375101

View in Genome Browser
Species Human (GRCh38)
Location 1:214465304-214465326
Sequence TGTCCACTCAAGAAAGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921375100_921375101 26 Left 921375100 1:214465255-214465277 CCAATGTCTACGTAACTTCAGTT 0: 1
1: 0
2: 0
3: 5
4: 66
Right 921375101 1:214465304-214465326 TGTCCACTCAAGAAAGTGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921375101 Original CRISPR TGTCCACTCAAGAAAGTGTT AGG Intronic
902011924 1:13276929-13276951 GGTCCCCTCCAGAAACTGTTTGG - Intergenic
904401707 1:30260989-30261011 TGACTACTCAAGAAAGCCTTTGG + Intergenic
905342044 1:37285937-37285959 TTTCTTCTCAAGAAAGTGTAAGG - Intergenic
907766373 1:57415700-57415722 TGTCTACTCACGAAAGTTCTAGG - Intronic
911442922 1:97951536-97951558 TGACCACTCAAATAAGTTTTGGG + Intergenic
911781320 1:101883032-101883054 TCTTCACTCAAGAAGGTCTTTGG - Intronic
911782524 1:101900560-101900582 TGTAAAGGCAAGAAAGTGTTTGG + Intronic
914858429 1:151368671-151368693 AGTGCACTAAACAAAGTGTTGGG + Intronic
914918995 1:151835006-151835028 TATCCACTTATCAAAGTGTTAGG + Intergenic
916144177 1:161725335-161725357 TGTCCGCTCAAGAAAGCAGTGGG + Intronic
921375101 1:214465304-214465326 TGTCCACTCAAGAAAGTGTTAGG + Intronic
924825436 1:247533234-247533256 AGTACTCTCAAAAAAGTGTTGGG + Intronic
924879644 1:248146042-248146064 AGAGCACTCAGGAAAGTGTTAGG + Exonic
1069146605 10:64900002-64900024 TGTTCACTGAAGAATATGTTGGG - Intergenic
1069172377 10:65248569-65248591 TGTATACTCATGAGAGTGTTAGG - Intergenic
1071041677 10:81316494-81316516 TCTCCACTCAAAAAAGTGTCTGG + Intergenic
1072392625 10:95003465-95003487 TTTCCACTAAAGAAAGTCCTGGG + Intergenic
1074321888 10:112410906-112410928 TGTCAAATCAAGAGAGTGGTGGG - Intronic
1076688556 10:132209156-132209178 TGTCCCCTCAAGTGAGTGTCTGG + Intronic
1078448929 11:11426020-11426042 TGTCAAATCAAGAAAATGGTGGG - Intronic
1078816916 11:14833824-14833846 TGTGCATTCAAAAAAGTGGTTGG + Intronic
1079032899 11:16998859-16998881 TACCCACCAAAGAAAGTGTTTGG - Intronic
1081952583 11:47057795-47057817 TGTATACTCCAGAAATTGTTTGG - Intronic
1084056703 11:66638611-66638633 TGGCCACTCAAGAAAGTAAAAGG - Intronic
1088069475 11:105764010-105764032 TGTCCTTTCAAGATTGTGTTTGG - Intronic
1088286556 11:108195522-108195544 TATCCACTTAAAAAATTGTTTGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1094635626 12:32224940-32224962 GATCCACTCACTAAAGTGTTGGG + Intronic
1095332637 12:40986781-40986803 TGTGTACTCAAGAAAGTTTTGGG - Intronic
1097608389 12:61784376-61784398 TGACCCCTCAAGAAGGTGTGAGG + Intronic
1098762396 12:74441371-74441393 TGTCCCCATAAAAAAGTGTTTGG + Intergenic
1103199958 12:119079767-119079789 TTTCCACCCATGAAACTGTTGGG + Intronic
1104630625 12:130398641-130398663 TGGCCACTCGAGCCAGTGTTTGG + Exonic
1105395605 13:20031035-20031057 TGTTCACTTAAGAAAATGTAAGG - Intronic
1105442994 13:20430661-20430683 AGCCCACTCAAGGAAGGGTTTGG - Intronic
1105844653 13:24283674-24283696 TTTCTACTCAAGACACTGTTGGG + Intronic
1106029741 13:25989232-25989254 TGTGCATTGAAGAAAGTGTTAGG + Intronic
1108537033 13:51393487-51393509 TGTTCACTAAACAAAGTTTTGGG - Intronic
1108809517 13:54204100-54204122 TTTCCAGTCATGAAAGTGCTGGG + Intergenic
1108924655 13:55726084-55726106 GGTAAACTCAAGAAAGTGTGAGG - Intergenic
1109082382 13:57921475-57921497 TGTTCACTCCAAAAAGTGGTTGG + Intergenic
1109220535 13:59636782-59636804 TGTCCACTTTAGCAAGAGTTGGG + Intergenic
1109721691 13:66283504-66283526 TGCCCACTTAAGAAAGAGCTGGG + Intergenic
1112113101 13:96324201-96324223 TAGCCACTCAATAAAGTTTTTGG - Intronic
1116537350 14:46048911-46048933 TGTCCACTTGAGAAAGTGAGAGG - Intergenic
1119003719 14:70906366-70906388 TGTAAACTCAAGTAAGTGATTGG - Intergenic
1119567635 14:75642044-75642066 TGCCCACTGAGGAAAGTCTTAGG - Intronic
1120342623 14:83241633-83241655 TGTCCAGTCTATAAAGTGGTGGG - Intergenic
1124733509 15:32221926-32221948 TATCATCTCATGAAAGTGTTTGG - Intergenic
1125119696 15:36139906-36139928 TGTCAACTTAAGAAACTTTTGGG + Intergenic
1131414828 15:92245653-92245675 TGACCACTCAAGGATGGGTTAGG - Intergenic
1132408105 15:101556949-101556971 TGTCCTCTCAAGTAAGTCCTGGG - Intergenic
1135433284 16:22405666-22405688 TGTCCACTGATGAAAGTGCTGGG - Intronic
1143646663 17:8234741-8234763 TGTCCCCTCCAGAAAGTATGAGG - Exonic
1144242516 17:13327292-13327314 TGTCCAGGCAAGAAAGGGTTTGG + Intergenic
1150131686 17:62672582-62672604 TGTCATCTCAAGAGATTGTTGGG + Intronic
1155079749 18:22397214-22397236 GGTCCAATCAAGAAAATGTTTGG + Intergenic
1158983129 18:62785101-62785123 TGTTCACTAAATACAGTGTTTGG + Intronic
1161627127 19:5333911-5333933 TGGGCACTCAGGAAAGTGATCGG - Intronic
1162968280 19:14165929-14165951 TTTCCTCTCCAGAAAGTTTTGGG - Intronic
926874012 2:17455336-17455358 TTTCCCCTTTAGAAAGTGTTTGG + Intergenic
928252243 2:29691370-29691392 TGTCCATTCATGAAAGAGCTTGG + Intronic
930223863 2:48772213-48772235 TGTCCACTAATAAAACTGTTAGG - Intronic
931546832 2:63397558-63397580 TGCCTACTCATGAAAATGTTGGG - Intronic
932132580 2:69201225-69201247 TGTCCATTCAAGAAGGCATTTGG - Intronic
943698995 2:190969556-190969578 CATCCACTCAAAAAAGTGTCTGG + Exonic
944465264 2:199994247-199994269 TGTCCATTGAGGAAAGTCTTTGG - Intronic
946319429 2:218942886-218942908 TGTCCACTAAAAAATGTTTTAGG + Intergenic
1170875716 20:20248169-20248191 ACTCCTCTCAAGCAAGTGTTAGG + Intronic
1178428302 21:32497159-32497181 TATCCACTGAAGATAGTATTTGG + Intronic
1179096289 21:38318656-38318678 TGTCCACTCAAGGACTTGGTTGG + Intergenic
957398948 3:79683913-79683935 TGTCCACTCAAAAACGTGTACGG - Intronic
959633684 3:108537258-108537280 TGTCCTCTCAGGAGAGTGTGTGG - Intergenic
960990246 3:123305436-123305458 TGCCAACTCAAAAAAGTGTCGGG + Intronic
961771477 3:129253211-129253233 TTTATACTCAAGAAAGTCTTTGG - Intronic
962305802 3:134284688-134284710 TGTCCACTCAATTAGGTGGTAGG + Intergenic
962970511 3:140396707-140396729 TGTCCACATAATAAATTGTTGGG - Intronic
966688330 3:182720407-182720429 TGTCCACTAAGGAAAGTCTCTGG - Intergenic
967794255 3:193581657-193581679 AGACCTCTCAAGAGAGTGTTAGG + Intronic
968885090 4:3324643-3324665 TGTCCACTGCAGAAATTCTTAGG + Intronic
969908079 4:10416309-10416331 TGTACACAAAAAAAAGTGTTAGG - Intergenic
970359002 4:15288520-15288542 TGTCTTCTCAACAAACTGTTGGG + Intergenic
973003505 4:44981769-44981791 TGTCCACTCAAAAAAAATTTTGG - Intergenic
975572269 4:75830002-75830024 CTACCACTCAAGAAAGTGATTGG - Intergenic
976439862 4:85060867-85060889 TGTCAAGTCAAGAAGGTGTAAGG + Intergenic
977011997 4:91647968-91647990 TGTATATTCCAGAAAGTGTTTGG + Intergenic
978964338 4:114723625-114723647 AGTCCACTCAAGTAAGCCTTTGG - Intergenic
981999822 4:151011975-151011997 TGGCCACTCTAGAAAATCTTTGG - Intronic
984677098 4:182562527-182562549 TTTTCACTCAAGAAAATGTATGG + Intronic
985248970 4:188004195-188004217 TGGCCTCCCAACAAAGTGTTGGG - Exonic
988564972 5:32313196-32313218 AGTGCACTCAAGAATGGGTTGGG - Intergenic
990936310 5:61153897-61153919 TGTACACTCCAGAAAATGTGTGG - Intergenic
993411018 5:87573208-87573230 TGTCTACTTAAGAAAGTCTTGGG - Intergenic
995209590 5:109521986-109522008 TCCTCACTCAAGAAAGTGTATGG + Intergenic
996596416 5:125208347-125208369 TGTACAGCCAAGGAAGTGTTTGG + Intergenic
998778500 5:145630103-145630125 TGTGTACTCAAAAAAATGTTTGG + Intronic
1000892077 5:166812219-166812241 TGTCAACTCTAGAAGGTGATGGG - Intergenic
1002114080 5:176944469-176944491 TGTCCTTTGAAGCAAGTGTTAGG - Intronic
1004694773 6:18023495-18023517 TGCCCCCTCAAAAAAGTATTTGG + Intergenic
1004762404 6:18682658-18682680 TTTCCACTAAAGAAATTCTTGGG - Intergenic
1009336158 6:62492875-62492897 GGTCCACTCCAGACTGTGTTTGG - Intergenic
1011689658 6:89854836-89854858 TGTACCATCAAGAAATTGTTTGG + Exonic
1015184287 6:130395727-130395749 AATCCCCTCAAGAAAGTGTGTGG - Intronic
1019255391 7:46533-46555 AGTCCACTCACCAAGGTGTTTGG + Intergenic
1021141762 7:17034232-17034254 TGGCCATTTAAAAAAGTGTTTGG + Intergenic
1022418273 7:30196987-30197009 TCCCCCCTCAAGAAATTGTTGGG + Intergenic
1023089574 7:36605097-36605119 TTTCCACTCAAGGAAATGGTTGG - Intronic
1024017359 7:45329248-45329270 TCTCCACTCACAAAGGTGTTGGG + Intergenic
1024330852 7:48153604-48153626 TGCCCACTCCAGAAATAGTTTGG - Intergenic
1027407866 7:77880998-77881020 TGTCCACTAGAGAGAGTGATTGG - Intronic
1032486106 7:132288653-132288675 TGTACACTCCAGTTAGTGTTTGG - Intronic
1033317133 7:140306692-140306714 TGTTCACACTAGAAAATGTTTGG - Intronic
1035933089 8:3805889-3805911 TGTCCACTACAAGAAGTGTTTGG - Intronic
1037090580 8:14911430-14911452 TGCACACTGAAGAAAGTATTTGG + Intronic
1039059425 8:33561794-33561816 TGGCCTCCCAAGAAAGTGCTGGG + Intronic
1042445259 8:68876964-68876986 GGTGCAGACAAGAAAGTGTTGGG + Intergenic
1042857444 8:73282047-73282069 TGTTAAATCAAGAAAATGTTGGG + Intergenic
1045121239 8:99038435-99038457 TGTCCACTTAAAAAAGTGAATGG - Exonic
1048685067 8:136895626-136895648 TCTTCACTCAAGAAAGTGAGAGG + Intergenic
1049437133 8:142591906-142591928 TCTCCACTCAAGGAAGGGCTTGG - Intergenic
1051056036 9:12987153-12987175 TGTCCCTTCAAGAATGTGGTTGG - Intergenic
1051190513 9:14506454-14506476 TTTCTTCTCAAGAAAGAGTTAGG - Intergenic
1057041253 9:91849151-91849173 AAACCACTCAAGAAAGGGTTTGG - Intronic
1057242064 9:93420029-93420051 TGTCCACTCAGGGAACTGATAGG - Intergenic
1059662517 9:116416027-116416049 TGTCCACTAAAGCAAGAGTTAGG + Intergenic
1061365296 9:130169665-130169687 TCTCCCCTCACGAAAGTGTAAGG + Intergenic
1061516860 9:131095209-131095231 TGTCCACTCACCCAAGGGTTTGG - Intergenic
1186339582 X:8629735-8629757 TGTCCTTTTATGAAAGTGTTTGG - Intronic
1188940087 X:36226702-36226724 TGTACACTTAAGAATGTCTTTGG + Intergenic
1194959671 X:100220838-100220860 TGTCCACTCAGGACAGCTTTGGG - Intergenic
1196407104 X:115375166-115375188 TGTCCATTCAAAAATGGGTTGGG + Intergenic
1197359550 X:125483085-125483107 TATCAACTCAAGATAATGTTGGG + Intergenic