ID: 921376862

View in Genome Browser
Species Human (GRCh38)
Location 1:214483471-214483493
Sequence AACTGGAGGCGGGTGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921376862 Original CRISPR AACTGGAGGCGGGTGGGGAA GGG (reversed) Intronic
900052796 1:608616-608638 AGCAGGAGGTGGGTGGGGACCGG + Intergenic
901012637 1:6210145-6210167 AGCTGGAGGCGGGTGGGGGATGG + Intronic
901393648 1:8964656-8964678 AACTGGGGGAAGCTGGGGAATGG - Intronic
901825910 1:11860886-11860908 AAATGGAGGTGGGTGGGTAAGGG + Intergenic
901960859 1:12825549-12825571 GAGTGGAGGGTGGTGGGGAATGG + Intronic
901967454 1:12880151-12880173 GAGTGGAGGGTGGTGGGGAATGG + Intronic
901975253 1:12939282-12939304 GAGTGGAGGGTGGTGGGGAATGG + Intronic
901982855 1:13050415-13050437 GAGTGGAGGGTGGTGGGGAATGG + Intronic
901986166 1:13076923-13076945 GAGTGGAGGGTGGTGGGGAATGG - Intronic
901995644 1:13149844-13149866 GAGTGGAGGGTGGTGGGGAATGG + Intergenic
901999234 1:13178503-13178525 GAGTGGAGGGTGGTGGGGAATGG - Intergenic
902009922 1:13262482-13262504 GAGTGGAGGGTGGTGGGGAATGG - Intronic
902017719 1:13321635-13321657 GAGTGGAGGGTGGTGGGGAATGG - Intronic
902283053 1:15388347-15388369 AACTGCAGGCAGGTGGGGCAGGG - Intronic
902843617 1:19092236-19092258 CACTGGGGGAGAGTGGGGAAAGG + Intronic
902933167 1:19745489-19745511 AAGTGGAGGGGGGTGGGCAGTGG - Intronic
903012892 1:20343464-20343486 CACCGGGGGCGGGTGGGGAAGGG - Intronic
903742184 1:25564773-25564795 AAAAGGAAGAGGGTGGGGAAGGG - Intronic
904339987 1:29828322-29828344 AAGTGGAGGGAGGTGGGGCAGGG + Intergenic
904404190 1:30275384-30275406 AAGTGGAGGGAGGTGGGGCAGGG - Intergenic
905205888 1:36342688-36342710 AGCTGGAGGTGGGTAGGGATTGG + Intronic
905657151 1:39692244-39692266 GACTGGCGGCGGCTGGGGACCGG - Intronic
905693051 1:39956473-39956495 AGCTGGTGCCGGGTGGGGACAGG + Intronic
906054556 1:42905064-42905086 AACTGGAAGAAGGTGGGGAGTGG + Intergenic
906564593 1:46789854-46789876 AAGTGGAGGCGTGTGGAGGATGG + Intronic
910590481 1:88924388-88924410 AATGGGAGGAGGATGGGGAAAGG - Intergenic
911126017 1:94341563-94341585 AACTTGACGCGGGAGTGGAAGGG - Intergenic
911823423 1:102448060-102448082 GACTGTTGTCGGGTGGGGAAGGG + Intergenic
912451921 1:109772706-109772728 AACTGGAAGCGGGTAGAGCACGG - Intronic
913481685 1:119294845-119294867 AACTGGATGGGGGTGGGGGTGGG - Intergenic
914476224 1:148025052-148025074 AACTGGGGGCGGGGGTGAAAAGG - Intergenic
914582131 1:149028902-149028924 GACAGGGGGCTGGTGGGGAATGG - Intronic
914667208 1:149841562-149841584 AACTGGGGGCGGGGGGCAAATGG - Intergenic
914668559 1:149852228-149852250 AACTGGGGGCGGGGGGCAAATGG + Intronic
915274770 1:154780825-154780847 AAAGGGAGGCGGGTGGGGGTTGG + Intronic
915327086 1:155086148-155086170 AACTGGGGGAGAGTGGGGACCGG - Exonic
915476328 1:156154759-156154781 AGCTGGAGGTGGGTGGAGGAAGG + Intronic
915612362 1:157004644-157004666 AACTGAAGACGGGTGGGGTGAGG + Intronic
915719905 1:157977303-157977325 CACTGGGGGCGGGAGGGGGACGG + Intergenic
916065330 1:161132027-161132049 AATTGGAGGTGGGAGGGGGAAGG - Intronic
916805837 1:168260514-168260536 CACTGGAAGTGGGTGGGAAAAGG + Intergenic
916958785 1:169868153-169868175 AACTAGGGGTAGGTGGGGAAGGG - Intronic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
917929865 1:179815713-179815735 AATTCGAGGAGGGTGGGGCAGGG + Exonic
919777521 1:201203892-201203914 AACTGGAGGCCAGTGGTGAGTGG + Exonic
919825879 1:201502789-201502811 CACTGGGGGCAAGTGGGGAAAGG - Intronic
919958615 1:202442968-202442990 AAGTGGTGGGGGGTGGGAAATGG + Intronic
920007652 1:202845081-202845103 GACTGGGGAGGGGTGGGGAAAGG + Intergenic
920224725 1:204430147-204430169 AAATGGAGGCTGCTGGGAAATGG - Intronic
920416355 1:205801332-205801354 TCCTGGAGGTGGGTGGGGAAGGG + Intronic
920431396 1:205921403-205921425 ACCTGGTGGCGTCTGGGGAAAGG + Intronic
920907427 1:210184759-210184781 AAATGGCGGGGGGTGGGGAGGGG - Intergenic
921376862 1:214483471-214483493 AACTGGAGGCGGGTGGGGAAGGG - Intronic
921882384 1:220270148-220270170 AACTTGATGAGGGTGAGGAATGG - Intronic
922002786 1:221496892-221496914 ACCTGGAGCAGGGTGGGAAATGG + Intergenic
922252795 1:223864856-223864878 AGCTGGCGGCGGGTGTGGACAGG + Intergenic
923447711 1:234087966-234087988 AGCTGGAGGCAGGTGTGGAGGGG - Intronic
924739727 1:246787995-246788017 GACTGGAGGAGGGTGGGGCGAGG + Intergenic
1063595982 10:7435981-7436003 AGATGGAGGGGGGTGGGGGAGGG + Intergenic
1064004609 10:11690079-11690101 ATCTCCAGGCGGGTGAGGAAAGG - Intergenic
1064302681 10:14136668-14136690 AACTGGAAGCGGGTGGGGATGGG - Intronic
1064454210 10:15471862-15471884 AAGTGGTGGCTGTTGGGGAAGGG - Intergenic
1064995795 10:21295966-21295988 AGCTGGAGGGAGGTGGGGAGAGG - Intergenic
1065204473 10:23344140-23344162 GAGTGGAGGGGGGTGGGGAACGG + Intronic
1069659905 10:70116792-70116814 ACCAGGAGGCTGGTGGGGACAGG + Intronic
1070141887 10:73744426-73744448 ATCTGGAGCCGGGTGAGGAGTGG + Exonic
1070564687 10:77594732-77594754 AACTGGAGGGAGGCTGGGAAAGG - Intronic
1072146564 10:92645112-92645134 AACTGGAGGAGGGTTGTGAAAGG + Intronic
1072619157 10:97068306-97068328 AACTGGGCTCGGGAGGGGAAGGG - Intronic
1073555230 10:104443687-104443709 AACTGTAGCTTGGTGGGGAAAGG + Intronic
1074828733 10:117233192-117233214 CACTGTAGCTGGGTGGGGAAAGG + Intergenic
1074869544 10:117565986-117566008 ATCTGAAGGCCGGGGGGGAAAGG - Intergenic
1075295966 10:121275540-121275562 AACTGGTGGCTGATGGGGCAAGG - Intergenic
1075301396 10:121327735-121327757 AACTGGGGGCAGGTGGGAATGGG - Intergenic
1076125565 10:127971338-127971360 ACCTGGAGTAGGGTGGGGATTGG + Intronic
1076669155 10:132110156-132110178 TACAGGAGGCCGGTGGGGCAGGG - Intronic
1077063313 11:627021-627043 CACTGGGGGCGGGTGGGGCCCGG + Intronic
1077304897 11:1864624-1864646 AGATGGAGGCGGGAGGAGAAGGG + Intronic
1077410610 11:2402273-2402295 AACTGCAGGTGGGTGGGGTGGGG - Exonic
1078194560 11:9124752-9124774 AGCTGGAGGAGGTTGGTGAATGG + Intronic
1078248938 11:9601404-9601426 AGCTGGAGGCTGGTGGTGGAGGG + Intergenic
1078597572 11:12701660-12701682 AACTGCAGGCTAGTGGGAAAAGG + Intronic
1078780621 11:14435672-14435694 ACCAGGAGGCGGTTGGGGAAAGG + Intergenic
1080268964 11:30430135-30430157 AACTGGAGGAGGTTAGGAAAGGG + Intronic
1080682051 11:34486304-34486326 CAGTGGAGGTGGGTGGGGAGTGG + Intronic
1080925904 11:36755591-36755613 AAGTGGAGGCAGGTGGAAAAGGG - Intergenic
1082006928 11:47424561-47424583 GACTGGAGGAGGGTGAGGAGCGG - Intronic
1082028150 11:47587407-47587429 GAGGGGAGGAGGGTGGGGAAGGG + Intronic
1083297858 11:61724896-61724918 TACGGGAGGCAGGTAGGGAAGGG - Intronic
1084108483 11:66997149-66997171 AGCTGGAGGAGGGTCAGGAATGG + Intergenic
1084162312 11:67356518-67356540 AGCTGGAGGCAGGTGGAGAGAGG + Intronic
1084489157 11:69468954-69468976 GGCTGGAGCCCGGTGGGGAAGGG + Intergenic
1084517414 11:69644335-69644357 GGCTGGAGGTGGGTGGAGAAAGG - Intronic
1084989355 11:72909045-72909067 AGATGGAGGGGGGAGGGGAAGGG - Intronic
1085315973 11:75545127-75545149 AGCTGGAGGCGGGTGGGGTGAGG + Intergenic
1085473308 11:76771924-76771946 GACTGGAGGGTGATGGGGAAGGG - Intergenic
1085598260 11:77830476-77830498 AAGTGGAGGTGGGTGGGGGGTGG - Intronic
1087016624 11:93560409-93560431 GACTGGTGGGGAGTGGGGAATGG - Intergenic
1087675122 11:101152702-101152724 AACTGGAGAGAGGAGGGGAAAGG - Intergenic
1088595129 11:111435517-111435539 AAATGGAGGCAGGCGAGGAAAGG + Intronic
1088722369 11:112605646-112605668 AACTGGAAGCAGATGGGGAATGG + Intergenic
1088934619 11:114387101-114387123 AACTGGAGGATGGTCGAGAAAGG + Intergenic
1089694517 11:120208915-120208937 AGCTGGTGGCGGATGGGGACAGG + Intergenic
1091304743 11:134530243-134530265 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304750 11:134530260-134530282 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304757 11:134530277-134530299 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304764 11:134530294-134530316 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304771 11:134530311-134530333 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304778 11:134530328-134530350 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304854 11:134530495-134530517 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091723041 12:2827141-2827163 AAGAAGAGGCGTGTGGGGAACGG - Exonic
1091741042 12:2960229-2960251 AAAGGGAGGCCGGTGTGGAAAGG + Intronic
1091820637 12:3472991-3473013 AGCTGGAGGTGGGGTGGGAATGG - Intronic
1092425955 12:8375699-8375721 ACCTGCAGGTGGGTGGGCAAGGG + Intergenic
1093758725 12:22881319-22881341 AACTGGAGAGGGGATGGGAAGGG + Intergenic
1095559343 12:43547345-43547367 TACTGGAGGGGGAGGGGGAAAGG + Intronic
1095732698 12:45522488-45522510 ATCAGGAGGTGGGTGGGGCAGGG - Intergenic
1096008581 12:48193169-48193191 AAATGGGGGTGGGTGGGGTAGGG + Intergenic
1096840125 12:54374900-54374922 GAGTGGAGCAGGGTGGGGAAGGG - Intronic
1097161551 12:57049789-57049811 GACTGGTTGAGGGTGGGGAAGGG + Intronic
1099228391 12:79995354-79995376 AGTTGGGGGAGGGTGGGGAAGGG - Intergenic
1100389642 12:94137341-94137363 AACAGGAGGAGGGAGTGGAAGGG - Intergenic
1101061143 12:100973616-100973638 AACTGTAGGCTGGGGGAGAAGGG - Intronic
1101686679 12:107030765-107030787 AACTGTGTGGGGGTGGGGAAGGG + Intronic
1102205177 12:111085390-111085412 ATCTGGGGGAGGGTTGGGAAGGG + Intronic
1102651487 12:114445602-114445624 ATTCGGAGGCGGGTGGGGGAGGG - Intergenic
1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG + Intergenic
1103237451 12:119385246-119385268 AACTGGAGGCTGGAGAGCAAGGG - Intronic
1103948646 12:124540467-124540489 AGCTGGAGGGGGATGGGGAGTGG + Intronic
1103948706 12:124540627-124540649 AGCTAGAGGGGGGTGGGGAGTGG + Intronic
1103948732 12:124540696-124540718 AGATGGAGGGGGGTGGGGAGTGG + Intronic
1103948806 12:124540896-124540918 AGCTGGAGGGGGGTGGGGAGTGG + Intronic
1103948815 12:124540921-124540943 AGCTGGAGGGGGATGGGGAGTGG + Intronic
1103948885 12:124541131-124541153 AGCTGGAGGGGGATGGGGAGTGG + Intronic
1103948946 12:124541315-124541337 AGCTGGAGGGGGATGGGGAGTGG + Intronic
1103948968 12:124541387-124541409 AGCTGGAGGAGGATGGGGAGTGG + Intronic
1103949077 12:124541708-124541730 AGCTGGAGGGGGATGGGGAGTGG + Intronic
1103949084 12:124541731-124541753 AACTGGAGGGAGATGGGGAGTGG + Intronic
1104448092 12:128848938-128848960 AAATGGAGGGGGGTGGGGAAGGG - Intergenic
1104759684 12:131289438-131289460 CAGGGGAGGCGGGTGGGGAAGGG + Intergenic
1104821029 12:131677775-131677797 CAGGGGAGGCGGGTGGGGAAGGG - Intergenic
1106299246 13:28448908-28448930 AACTGGATGCAGGAGGGGAATGG - Intronic
1106429427 13:29665869-29665891 AACTGGAGCTTGGTGGGAAAAGG + Intergenic
1106610213 13:31272079-31272101 AACTGGAGGGTGGGGGGAAAAGG - Intronic
1107662213 13:42650425-42650447 AAGAGGAGGAGGATGGGGAAGGG + Intergenic
1107833768 13:44397344-44397366 CACTGGAGGCGGGAGGACAACGG + Exonic
1107850589 13:44568760-44568782 AATGGGAAGAGGGTGGGGAAAGG + Intronic
1108324049 13:49312925-49312947 TGCTGGAGGTGGGAGGGGAAAGG - Intronic
1109299193 13:60573236-60573258 AACTGGAGGCGGTTAGGATAGGG + Intronic
1111162752 13:84417367-84417389 AACTGGAGCTGAGTGAGGAAGGG + Intergenic
1111906997 13:94266531-94266553 GACTGAGGGAGGGTGGGGAAGGG - Intronic
1111919513 13:94395924-94395946 AACTGGAAGCTGGTGGGCAAGGG - Intronic
1112245525 13:97729988-97730010 AACTGAAAGCAGGAGGGGAAAGG - Intergenic
1112272148 13:97977371-97977393 AACTGGAGGTGGGAGGGGGTAGG - Intronic
1113662866 13:112118831-112118853 TGCTGGAGGTGGGTGGGGAGGGG + Intergenic
1113787471 13:113010145-113010167 GACTGGAGGCGGGTGGGCCCTGG - Intronic
1114483012 14:23047135-23047157 AGGGGGAGGCGGCTGGGGAAGGG - Exonic
1115167147 14:30461772-30461794 ACCTGGAGGGTGGTGGGGCAGGG + Intergenic
1115459326 14:33642264-33642286 ATCTGGGGGATGGTGGGGAATGG - Intronic
1116348697 14:43830485-43830507 AAATGGAGGAGGGTGTGAAAGGG + Intergenic
1118240044 14:64047185-64047207 AGCTGGAGGGGGGATGGGAAGGG + Intronic
1119696953 14:76720672-76720694 CGCAGGAGGCTGGTGGGGAAGGG + Intergenic
1121720933 14:96108263-96108285 CAGTGGAGGCAGGTGGGGACAGG - Intergenic
1122112126 14:99510299-99510321 AGCTGGAGGGGGGTGGGGGCGGG - Exonic
1122280743 14:100620841-100620863 TGCTGTCGGCGGGTGGGGAAGGG - Intergenic
1122883204 14:104699305-104699327 CAATGGAGGCGGGGGAGGAAAGG + Intronic
1123055301 14:105566566-105566588 GACTGGACGGGGGTGGGGGAGGG + Intergenic
1123079750 14:105686410-105686432 GACTGGACGGGGGTGGGGGAGGG + Intergenic
1123799895 15:23808734-23808756 AAGTGGAGGGAGGTGGGGCATGG + Intergenic
1124635988 15:31365596-31365618 AGCTGGAGCCGGGTGGGGTGGGG + Intronic
1125021563 15:34991555-34991577 TTTTGGAGGAGGGTGGGGAAAGG + Intergenic
1125348739 15:38745562-38745584 AACTGGAGTCAAGTGGGGACTGG + Intergenic
1125703974 15:41715063-41715085 CACTGGGGGCGGGTGGGCAGTGG - Intronic
1125828413 15:42694356-42694378 GCCTGGAGTCGGGAGGGGAAGGG + Intronic
1125979875 15:43990189-43990211 AGCTGGCGGCGGGTGTGGACGGG + Intronic
1126088357 15:45029802-45029824 AACTGGAGAGGGGATGGGAAGGG + Intronic
1126278441 15:46913823-46913845 GACTGGAGGGGTGTGGGAAATGG + Intergenic
1127064814 15:55225986-55226008 AAATGGGGGCAGGTGTGGAAAGG + Intronic
1127278635 15:57469713-57469735 AATTGGAGGGTGGTGGTGAAGGG - Intronic
1127550660 15:60034526-60034548 ACCTGGAGCCCTGTGGGGAAAGG + Intronic
1127623031 15:60752618-60752640 AACTCGAGGCGGGTGGGGGTGGG - Intronic
1127733552 15:61821212-61821234 CACGGGAAGAGGGTGGGGAAGGG - Intergenic
1129101159 15:73265328-73265350 AGCTGGAGGCAGGGTGGGAAGGG + Intronic
1129127572 15:73457310-73457332 AACTGCCAGAGGGTGGGGAAAGG - Intronic
1129333282 15:74838564-74838586 AGGGGGAGGCGGGTGGGGAGAGG - Intronic
1130002538 15:80059869-80059891 AGCTGCAGCCGGGTGGGGGAAGG - Intronic
1130130907 15:81142072-81142094 AGCTGGACGTGGGTGGGGAAGGG - Intronic
1130653309 15:85774640-85774662 TAGTGGAGGCGGGTGGGAAGGGG - Intronic
1131215981 15:90535493-90535515 GAGTGGACGGGGGTGGGGAATGG + Intronic
1131264250 15:90906362-90906384 AACTATAGGCTGGTGGGAAACGG + Exonic
1131336157 15:91551394-91551416 AACTGGAAGCCTGAGGGGAAGGG - Intergenic
1131568398 15:93506786-93506808 ACCTGTTGGCGGGTGAGGAAGGG + Intergenic
1132551885 16:556944-556966 GCCGGGAGGCGGGTGGGGAGGGG + Intergenic
1133141998 16:3751958-3751980 AACAGGGGGCAGGTGGGGAAAGG + Intronic
1133372390 16:5255201-5255223 ACCTGCAGGTGGGTGGGCAAGGG - Intergenic
1134223987 16:12377490-12377512 AACTGCAGGTGGGTGGGGAGGGG + Intronic
1134300987 16:12990653-12990675 AACTGGAGGTGGATGGGGGGTGG + Intronic
1135293889 16:21263008-21263030 AACTGGTTGAGGGTGAGGAATGG - Intronic
1135357161 16:21778958-21778980 GACTGGGGTGGGGTGGGGAATGG + Intergenic
1135455665 16:22595074-22595096 GACTGGGGTGGGGTGGGGAATGG + Intergenic
1136233320 16:28900497-28900519 AGCTGGTGGGGGGTGGGGATGGG - Intronic
1136353105 16:29724726-29724748 AACTGGAGGTGGGGAGGAAACGG - Intergenic
1136396669 16:29996231-29996253 AAGTGGAGGCGGGAGCGGCACGG + Exonic
1136556619 16:31010813-31010835 GCCTGGAGGCGGGTGGGGGTGGG + Intergenic
1136621006 16:31428238-31428260 AGCAGGAGGTGAGTGGGGAACGG - Exonic
1137275692 16:46931944-46931966 CACTGGAGGCCCGTGGGCAAAGG + Intergenic
1137636637 16:49992671-49992693 AAGTGGAGGCAGGTGGATAACGG + Intergenic
1137727518 16:50667140-50667162 AACTGGAGGCGGGCGGTGCATGG + Intronic
1137840365 16:51635849-51635871 AACAGAAGGCTGGTGGTGAAAGG + Intergenic
1138372244 16:56536448-56536470 AACTGGAAGCCGGTGAGGAAAGG + Intergenic
1138530739 16:57632998-57633020 ACCTGGGGACGGGAGGGGAAAGG - Intronic
1139808521 16:69591285-69591307 AACTGGGGCGGGGTGGGGAGGGG - Intronic
1140213633 16:72990154-72990176 AACTGCAGGAGGGTGGGGAAGGG + Intronic
1140224312 16:73066293-73066315 AACGAGAGGCGGGGAGGGAAGGG - Intergenic
1140354901 16:74297169-74297191 AAGTGGCGGCGGCTGGGGCAGGG - Intronic
1140985655 16:80156006-80156028 ACCTGGAGAGGGGAGGGGAAGGG + Intergenic
1141518138 16:84559893-84559915 AACTGGAGGAGGGAGGGAAGAGG + Intergenic
1142029573 16:87831812-87831834 CTCTGCAGGCGGGTGGGGACTGG + Exonic
1142284865 16:89167593-89167615 CAGTGGAGGCGGGTGGGGGAAGG - Intergenic
1145110319 17:20156294-20156316 AGCCGGAGGCGGTGGGGGAAGGG - Intronic
1145964264 17:28905853-28905875 AGCAGGAGGTGGGTGGGGAAGGG + Exonic
1147178287 17:38670150-38670172 AACAGGAGCCGCCTGGGGAAAGG - Intergenic
1147333409 17:39712293-39712315 AGGTGGGGGTGGGTGGGGAAGGG - Intronic
1147337965 17:39738439-39738461 GTCTGGAGGCCGGTAGGGAAAGG + Intronic
1147466142 17:40612775-40612797 CACTGGAGGCGGGTGCTGAAAGG - Intergenic
1147557582 17:41489188-41489210 AAGGGGAGGGGGGTGAGGAACGG + Intronic
1147732526 17:42612926-42612948 ACCTGGTGGGGGTTGGGGAAAGG - Exonic
1148353662 17:46959338-46959360 AAAAGGATGTGGGTGGGGAACGG - Intronic
1148437384 17:47694586-47694608 AATGGAAGGCGGCTGGGGAAGGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1150010508 17:61498315-61498337 TTCTGGAGGTGGGAGGGGAAAGG + Intergenic
1150028576 17:61706483-61706505 AACAGGAGGTGGGTAGGGAAAGG - Intronic
1151236344 17:72722501-72722523 AACTGGGGTGGGGTGGGGGAGGG + Intronic
1151293012 17:73164168-73164190 ACTTGGAGGAGGGTGAGGAAGGG + Intergenic
1151474434 17:74337825-74337847 AGCTGGAGAGGGGTGGGGACAGG - Intronic
1151734380 17:75929946-75929968 AACTGGGGGTGGGTGGGGTGGGG - Intronic
1151852195 17:76697656-76697678 AGGTGGAGGCGGGAGGGGGAAGG + Intronic
1152073262 17:78144528-78144550 TGCTGAAGGCGGGTGGGGAAGGG - Intergenic
1152495940 17:80671554-80671576 AACTTAAGTCGGTTGGGGAAGGG + Intronic
1152509260 17:80774194-80774216 AACTCAAGGCGGGTGGAGACGGG - Intronic
1152681451 17:81670456-81670478 GAGTGGAGGCGGGAGGGGGAGGG + Intronic
1152755388 17:82084986-82085008 ATGGGGAGGCTGGTGGGGAAGGG + Intronic
1153961252 18:10141931-10141953 AATTTGTGGCGGGTGGGAAATGG - Intergenic
1155269627 18:24127456-24127478 AAGGGCAGGTGGGTGGGGAAAGG - Intronic
1155517195 18:26635981-26636003 AACTGCAGGAGGGTGTGGGAGGG + Intronic
1155594775 18:27472984-27473006 AACTTGAGCCGGGTGGGGAGTGG + Intergenic
1156450690 18:37264696-37264718 CATTGGAGGCGGCTGAGGAAAGG + Exonic
1156729472 18:40173810-40173832 GAATGGAGGTGGGTGGAGAAAGG + Intergenic
1157280578 18:46344353-46344375 AGCTGGGGGCGGGGGGAGAAGGG - Intronic
1157752913 18:50194658-50194680 TACTGGAGGCGGGAGGTGACGGG - Intronic
1159493016 18:69162980-69163002 AACAGGAGAGGGGAGGGGAAGGG - Intergenic
1160893718 19:1393148-1393170 AGTTGAAGGCGGGTGGGGATGGG + Intronic
1161407232 19:4097459-4097481 AATTGGAGGCGGGTGTGCAGAGG + Intronic
1161477688 19:4495574-4495596 AAAAGGAGGGCGGTGGGGAACGG + Intronic
1161552717 19:4923123-4923145 AACTGGTGGCGGGTAGGCAGGGG - Intronic
1161868257 19:6850604-6850626 AACTGGGGCTTGGTGGGGAATGG + Intronic
1162792983 19:13072532-13072554 AGCTGGAGCTGGGTGGGGGATGG + Intronic
1163513525 19:17749452-17749474 ACCAGGAGGAGGGAGGGGAAGGG + Intronic
1163632924 19:18426279-18426301 AGCTGGAGGCGGCTGTGGAAGGG + Intronic
1163712583 19:18855459-18855481 AACTGGGGGCAGGGGGGGCATGG + Intronic
1164777539 19:30864630-30864652 AAGTGGGGGCGGGAGGGCAATGG - Intergenic
1166101893 19:40576237-40576259 AACTGGAGGGGGGAGGAGAGAGG - Exonic
1167033021 19:46976235-46976257 AACGGGAGGGTGGTGAGGAATGG - Intronic
1167374304 19:49102972-49102994 CACGGGAGGGGAGTGGGGAAAGG - Intronic
1167750840 19:51379330-51379352 AACTGGAGGCGGGGTGGGCAGGG + Intergenic
1168356618 19:55704190-55704212 AACGGGGGGCGGGTGAGCAAGGG - Intronic
1168471280 19:56643022-56643044 ACCTGGAGGCGCGTGGGGAAGGG - Intergenic
1168502726 19:56906934-56906956 ATCTGGAGGAGCGTTGGGAAGGG + Intergenic
1168508831 19:56958508-56958530 AGCTGGAGGCGGGAAGGGGAGGG - Intergenic
1168509255 19:56961514-56961536 AAGAGGAGGGGGGAGGGGAAGGG - Intergenic
926351678 2:12001074-12001096 AAGTGGTGGCGGGTGAGAAAGGG + Intergenic
926402205 2:12509002-12509024 CACTGGAGCCTGTTGGGGAAGGG - Intergenic
926707027 2:15844206-15844228 ACCTGGAGGCGGGTGAAGAGGGG - Intergenic
927199280 2:20568398-20568420 AGCTGGAGCCGGGCGGGTAATGG + Intronic
927499239 2:23571237-23571259 GACTGGAGGATGGCGGGGAATGG + Intronic
927894879 2:26775285-26775307 AAGTGGAGGTGGGTGGGATAGGG - Intronic
927982622 2:27383937-27383959 AAGAGGAGGTGTGTGGGGAAGGG - Exonic
927989435 2:27437113-27437135 GACTGGAGGGGAGGGGGGAAAGG + Intronic
928023993 2:27725009-27725031 AACAGGAGACGGGAGGGGCATGG - Intergenic
928135491 2:28684678-28684700 AACTGGAGTCAGATGGTGAAGGG - Intergenic
928172018 2:29010220-29010242 GATTGGAGGCGGGCGGGGAGGGG - Intronic
928413043 2:31068990-31069012 ACCTGGAGCGGGGTGGGGCATGG + Intronic
928975717 2:37084425-37084447 AATTCGCGGCGGGTGGGGATAGG - Intergenic
930887785 2:56347710-56347732 AACTGGAGGAGGGTGGATAGGGG + Intronic
931364924 2:61611149-61611171 AACAGGAGAAGGGTGAGGAATGG - Intergenic
932756848 2:74415229-74415251 AACTGGACGCGGCTGGGGATCGG - Exonic
932844798 2:75124079-75124101 ATCTGGAGGCGTGTGGGATATGG + Intronic
932893271 2:75613960-75613982 AATTGGAAGAGGGTGGAGAAAGG + Intergenic
933236500 2:79870461-79870483 AAGGGGAGGGGAGTGGGGAAGGG + Intronic
934537285 2:95145650-95145672 AACTTGAAGCTGGTGGGGAAGGG - Intronic
934987124 2:98895570-98895592 AGCTGGATTAGGGTGGGGAAGGG + Intronic
935274527 2:101464552-101464574 AAATGGAGAAGGGAGGGGAAGGG - Intronic
935562880 2:104576850-104576872 AGGTGGTGGGGGGTGGGGAATGG - Intergenic
936489311 2:112956721-112956743 AAGTGGAGGAGGGTGGGGAAGGG + Intergenic
937893092 2:126955209-126955231 CACTGGAAGAGGATGGGGAAAGG - Intergenic
938094473 2:128452484-128452506 TAATGGAGGCTGGTGGGTAATGG - Intergenic
938173302 2:129102032-129102054 AACAGGAGGCAGATGGGAAAAGG - Intergenic
938196855 2:129335972-129335994 AGCTGGAGGGGTCTGGGGAAAGG - Intergenic
938861293 2:135372452-135372474 AACTGGAGGTGGGTGGTAGAAGG + Intronic
940905374 2:159164491-159164513 AGCTCCAGGTGGGTGGGGAAAGG + Intronic
941044035 2:160652643-160652665 AAGTGGAGGAAGGTGGGGCATGG - Intergenic
946164916 2:217858019-217858041 CACAGGAGGCCGGTGGGGAATGG + Intronic
946320537 2:218951657-218951679 AATTGGGGGCGGGTGGGGGATGG - Intergenic
946890475 2:224270598-224270620 AACTGGAGGAAGCTGGGGGATGG + Intergenic
947021517 2:225682562-225682584 AACTGGAGGTGGAGGAGGAAAGG + Intergenic
947107857 2:226686287-226686309 AGGTGGTGGCGGGTGGGGCATGG + Intergenic
947351680 2:229252880-229252902 ACAAGGAGGTGGGTGGGGAAGGG + Intronic
947670883 2:231934645-231934667 CACAGGAGGTGGGTGGGGTAGGG + Intergenic
948002577 2:234580395-234580417 AACTGGAGGAGGATGGGACAAGG - Intergenic
948109817 2:235445465-235445487 AACAGGTGGCGGGTGGGGTAGGG - Intergenic
1170318442 20:15067766-15067788 GATTGGATGGGGGTGGGGAATGG + Intronic
1172035860 20:32010392-32010414 AACTGGATGTGGGGGTGGAAGGG + Intergenic
1173044383 20:39495389-39495411 GACTGGTGTGGGGTGGGGAATGG + Intergenic
1173256212 20:41395807-41395829 AGCTGGAGGGCGGTGGGGCAGGG - Intergenic
1173590606 20:44221918-44221940 AACTGGAAGGGACTGGGGAAAGG - Intergenic
1175550988 20:59817532-59817554 CACAGGAGGCGGGTGGGGGATGG + Intronic
1175653181 20:60746627-60746649 AGCTGGAGGAGGGTGGGGACAGG + Intergenic
1176312189 21:5157980-5158002 TAGGGGAGGCGGGTGGGGGAGGG - Intergenic
1178045763 21:28692986-28693008 AGCTGGAGGAGGGGGAGGAATGG + Intergenic
1178240519 21:30894287-30894309 AGGTGGAGGGGAGTGGGGAATGG + Intergenic
1178301864 21:31459873-31459895 AACTGGAGCCGGATGGTGCATGG + Intronic
1178486093 21:33020875-33020897 AGCTGGAGGCGGGTGGGTGGGGG + Intergenic
1178706907 21:34883334-34883356 TGGTGGAGGCGGGTGGGTAAAGG + Intronic
1179152676 21:38822235-38822257 AACTGGAGGCGGGGTGGGAATGG - Intronic
1179719295 21:43306270-43306292 AGCTGGAGGGGGGTGGGGCAGGG + Intergenic
1179844859 21:44104050-44104072 TAGGGGAGGCGGGTGGGGGAGGG + Exonic
1181649487 22:24250952-24250974 ACCCGGGGGCGGGCGGGGAAGGG - Intergenic
1181707884 22:24659794-24659816 ACCCGGGGGCGGGCGGGGAAGGG + Intergenic
1182152124 22:28035178-28035200 GCCTGGAGGGGGGTGGGGAATGG - Intronic
1182446488 22:30392683-30392705 AACTGGAGACTGGTGAGAAAGGG + Intronic
1182941363 22:34280536-34280558 CACTGGAGGCAGGTGGGAAGAGG + Intergenic
1183247079 22:36702287-36702309 ATTTGGAGGAGGGTGGGGAGGGG + Intronic
1184348052 22:43925035-43925057 AACTGGAGTCTAGTGGGGAGGGG + Intronic
1184445454 22:44544479-44544501 AAGTGGGGGCAGGTGGGGACAGG + Intergenic
1184858478 22:47160071-47160093 AGGTGGAGGAGGGTGGGGGAAGG + Intronic
949153460 3:799146-799168 AACTAGAAGGGGCTGGGGAACGG + Intergenic
949189576 3:1235856-1235878 TGCTGGGGGCGGGTGGGGCATGG + Intronic
949347798 3:3092994-3093016 AACTGGATGTGAGTGGGGAGGGG - Intronic
949927724 3:9055389-9055411 AACTGGAGGCCCCTGGAGAAAGG - Intronic
950099879 3:10350198-10350220 ATCTGGAGAGGGATGGGGAAGGG + Exonic
950750824 3:15126813-15126835 ACCTGCAGGTGGGTGGGCAAGGG - Intergenic
951112372 3:18819364-18819386 AACTGGAGTCAGGTGGGGCTGGG + Intergenic
951235882 3:20236070-20236092 AACTGGGGAAGGGAGGGGAAGGG - Intergenic
951873214 3:27390266-27390288 AAGTGGGGTCGGGTGGGGGAGGG + Intronic
952490889 3:33871489-33871511 AAAAGGAGGGGGATGGGGAAGGG + Intergenic
952943540 3:38460648-38460670 CTCTGGAAGCGGGTGTGGAAAGG + Intronic
953576384 3:44116185-44116207 AAAGGGAGGAGGGTAGGGAAGGG - Intergenic
953852624 3:46477871-46477893 AACTGGAGCCGCCTGGGGAAAGG - Intronic
954100839 3:48371529-48371551 ACCTAGAGGGGCGTGGGGAAAGG - Intergenic
954216339 3:49126496-49126518 ACCTGGGGGCGAGTGGGGACAGG + Exonic
954382346 3:50226414-50226436 GGCGGGAGGCGGGAGGGGAAAGG + Intronic
954411875 3:50374374-50374396 GAGTGGAGGTGGGTGGGGAGGGG + Intronic
954670879 3:52290798-52290820 AATGGGAAGCGGGTGGGGAGGGG - Intronic
954676402 3:52317973-52317995 GAGTGGACGAGGGTGGGGAATGG + Intronic
954798203 3:53172203-53172225 AACAGGAGGTGGGAGGGGAAAGG - Intronic
955157328 3:56429468-56429490 AATTGGAGGAGAGTGGGGCAAGG - Intronic
955881456 3:63550913-63550935 AACTGGAAGATGGTGGGAAAGGG - Intronic
956604894 3:71064623-71064645 AAGTGGAGGCGGGGAGGGAGTGG - Intronic
956734534 3:72228138-72228160 AGCTGGGGGAGGGTGGGAAATGG - Intergenic
957070622 3:75564998-75565020 ACCTGTAGGTGGGTGGGCAAGGG + Intergenic
958795335 3:98701191-98701213 CACTGGGGGTGGGTGGGAAATGG - Intergenic
959431076 3:106256182-106256204 GCCGGGGGGCGGGTGGGGAAAGG - Intergenic
960997792 3:123351169-123351191 AAGTGGAGACAGGTGGGGACTGG + Intronic
961283469 3:125781568-125781590 ACCTGCAGGTGGGTGGGCAAGGG - Intergenic
961666073 3:128493773-128493795 AACTGGAGGGGGGGTGGGACAGG - Intergenic
961893519 3:130149267-130149289 AACAGAAAGAGGGTGGGGAAAGG + Intergenic
962609461 3:137062022-137062044 AACTGGGGGCGGGGAGGGGATGG + Intergenic
962948990 3:140200800-140200822 AAGAGGAGGCAGGTGGGGGAGGG - Intronic
963284138 3:143416978-143417000 TGCTGGAGGAGGATGGGGAAAGG + Intronic
964381638 3:156103620-156103642 CACTGGAGGAGGCTGGGGAAGGG - Intronic
964722759 3:159783634-159783656 AACTGGAGTGGAGTGGAGAATGG + Intronic
965360562 3:167734547-167734569 AGGTGGGGGCGGGAGGGGAAGGG - Intronic
965387243 3:168059735-168059757 GACTGGAGGCGTGGGGAGAATGG + Intronic
966014836 3:175129468-175129490 GACTGGACAGGGGTGGGGAATGG - Intronic
966332126 3:178826161-178826183 AAAGGGAGGAGGGTGGGGAACGG - Intronic
966938919 3:184732973-184732995 GACTGGAGCAGGGTGGGGAGTGG - Intergenic
967370326 3:188737561-188737583 AACTGAGGGCGAGTGGGAAAGGG - Intronic
969613051 4:8237663-8237685 ACCTGAAGGTGGGTGGGGAGGGG + Exonic
969739736 4:9015747-9015769 ACCTGCAGGTGGGTGGGCAAGGG - Intergenic
969798901 4:9547291-9547313 ACCTGCAGGTGGGTGGGCAAGGG - Intergenic
971786837 4:31115073-31115095 AAGTGGAGGAGGGAGGGAAACGG - Intronic
973022458 4:45220414-45220436 AGCTGGAGAGGGGAGGGGAAGGG + Intergenic
973607205 4:52599801-52599823 AGCTGGAGGAGGCTGGAGAAAGG - Intronic
975668828 4:76759777-76759799 CTCTTGAGGCAGGTGGGGAAAGG + Intronic
976008850 4:80462567-80462589 AAATAGATGGGGGTGGGGAAGGG - Intronic
976725403 4:88211354-88211376 AAGTGGGGGGGGGTGGGGCAGGG - Intronic
977040693 4:92013625-92013647 TACTGGGAGCGGGTGGGGATTGG - Intergenic
978618533 4:110618687-110618709 ACCTGGGGGCGGTTGGGGCAAGG + Exonic
979312879 4:119224706-119224728 AACTCCAGGAGGCTGGGGAAAGG + Intronic
979733368 4:124052346-124052368 AAGTGGAAGCGTTTGGGGAAAGG + Intergenic
980615931 4:135225639-135225661 AGCTGGGGGCGGAGGGGGAAAGG + Intergenic
980638091 4:135535897-135535919 AAGGGGAGGGGGGTGGGGAGGGG + Intergenic
983284783 4:165725781-165725803 AACTGGAGGAGAGTGTGGACAGG + Intergenic
984539480 4:181019798-181019820 AACTGTTGGGGGGGGGGGAAAGG + Intergenic
984559954 4:181256563-181256585 GAGTGGAGAAGGGTGGGGAAAGG - Intergenic
985504209 5:269710-269732 AAGTGGGGGCGGGTGGGACATGG - Intergenic
985645239 5:1081830-1081852 CACTGGTGGCCGGAGGGGAAGGG + Intronic
985914400 5:2906610-2906632 AAGTGGGGGCAGGTGGGGACAGG - Intergenic
986353882 5:6905464-6905486 CACTGGAGACAGGTGGAGAATGG - Intergenic
990517535 5:56544295-56544317 ACATGGAGTTGGGTGGGGAAAGG + Intronic
990557812 5:56952386-56952408 AATTGGAGGCAAGTGGGGGACGG + Intronic
991575119 5:68094927-68094949 AAGTGGGGAAGGGTGGGGAAAGG - Intergenic
992147780 5:73869219-73869241 GGGTGGAGGGGGGTGGGGAAGGG + Intronic
992431952 5:76718204-76718226 AAGTGGTGGCGGGTGGGGCAGGG + Intronic
993518155 5:88863641-88863663 AAATGGAGGCGGGAGTGGATGGG - Intronic
995480247 5:112585991-112586013 AAGTGGAGGTGAGTGGGGATTGG + Intergenic
996308424 5:122077223-122077245 CACTGCAGGCGCGTGGGGGAGGG + Intronic
996624450 5:125553122-125553144 ATTTGGAGGCGGGTGGTGAAAGG - Intergenic
997165924 5:131660120-131660142 AACTGGTGGCAGGTGTGGATGGG + Intronic
997251838 5:132394665-132394687 CACTAGAGGGGAGTGGGGAAAGG - Exonic
998164767 5:139836727-139836749 GAGAGGAGGCTGGTGGGGAAAGG + Intronic
998482542 5:142474833-142474855 AAAGGGAGTAGGGTGGGGAATGG - Intergenic
999592044 5:153158828-153158850 AAAAGCAGGCGGGTGGAGAAAGG - Intergenic
999730493 5:154473585-154473607 ATCTGGCGGCGGGTGGCGAGAGG + Intergenic
1000247218 5:159458654-159458676 AACTGGTGGGGTGTGGGGAAAGG - Intergenic
1000880047 5:166686969-166686991 AAGTGGGGGCCGGTGGGGGAGGG - Intergenic
1001628241 5:173154874-173154896 AAGTGGGGGCGAGTGGGGAAGGG + Intronic
1002073859 5:176696634-176696656 ACCTGGAGGGGCCTGGGGAATGG + Intergenic
1002306512 5:178286815-178286837 TGCTCGAGGCTGGTGGGGAACGG + Intronic
1002796011 6:471497-471519 AAGTGGAGGCAGGTGGGCAGAGG - Intergenic
1003522253 6:6868250-6868272 ATCTGATGGTGGGTGGGGAATGG + Intergenic
1005327954 6:24720554-24720576 TACTGGCGGCGGAGGGGGAAGGG + Exonic
1006359606 6:33579931-33579953 GCCGGGAGCCGGGTGGGGAAGGG - Intronic
1007100052 6:39239831-39239853 GTTGGGAGGCGGGTGGGGAAGGG + Intergenic
1007254084 6:40516476-40516498 ATCTGAAGGCAGCTGGGGAAGGG + Intronic
1007451713 6:41945124-41945146 AATTGGAGGAGGGGTGGGAATGG + Intronic
1007967286 6:46015081-46015103 AACGGGAGGAGGGGGAGGAATGG - Intronic
1008309756 6:49952418-49952440 AAATGGAGGAAGGTAGGGAATGG - Intergenic
1010005854 6:70994089-70994111 AACAGGAGGCAGGTGGGTGAGGG + Intergenic
1011622152 6:89253087-89253109 AACAGGAGGAGGGTGGGGCTGGG - Intergenic
1012052612 6:94362554-94362576 GCCTGGAGGGGGGTGGGGAGGGG + Intergenic
1013673502 6:112431451-112431473 AGCTAGAGGAGGGTAGGGAAAGG + Intergenic
1014187974 6:118457588-118457610 AACAGAAGGCGGGTGGGGGTGGG - Intergenic
1014832506 6:126119513-126119535 AACTGGTGGCTGTTGGGGAAAGG + Intergenic
1015822925 6:137282164-137282186 AAGTTGAGGCGGGTGGGTAGGGG + Intergenic
1016384956 6:143521842-143521864 ATCTGGATGCAGGTGGGGAAGGG + Intergenic
1016460354 6:144275020-144275042 AAGTGGAGGGTGGTGGGGACAGG - Intergenic
1018875891 6:167822211-167822233 AACAGGAGGAAGCTGGGGAAGGG + Intergenic
1019328623 7:452056-452078 GAGTGGGGCCGGGTGGGGAAGGG - Intergenic
1019376361 7:694609-694631 CACTGGAGGTGGGTGGGGGAAGG - Intronic
1020125468 7:5530522-5530544 ACCTGGCGGCGGGTGTGGACGGG + Exonic
1020194440 7:6026297-6026319 AACAGCAGGCAGGTGGTGAAGGG + Intronic
1022153317 7:27632899-27632921 GACTGGAGGATGGTGGGGACTGG - Intronic
1023286723 7:38629170-38629192 AAATGGAGGCTGCTGGAGAAAGG - Intronic
1023432045 7:40104012-40104034 AACTGGGTGGGAGTGGGGAAGGG + Intergenic
1023548636 7:41345131-41345153 AACTGCAGGGAGGTGGGAAAGGG + Intergenic
1024044969 7:45579957-45579979 AAATGGGGGCGAGGGGGGAAGGG - Intronic
1024226072 7:47327833-47327855 CAGTGGAGGGGGGTGGGGAGGGG - Intronic
1024477743 7:49831634-49831656 TACTGGAGGTGGGAGGGCAAAGG + Intronic
1024642842 7:51344949-51344971 TAATGGAGGGGGGTGGGGCAAGG + Intergenic
1024967366 7:55035864-55035886 TACTGGAGGAGGTTGGGGGAAGG - Intronic
1026018740 7:66692673-66692695 GGTGGGAGGCGGGTGGGGAAGGG - Intronic
1026363145 7:69621382-69621404 AAGTGGAGGCGAGTGGGGTAGGG - Intronic
1026670067 7:72382599-72382621 AAAGGGAGGGAGGTGGGGAAGGG - Intronic
1026867526 7:73832712-73832734 CTGTGGAGGTGGGTGGGGAAGGG + Intergenic
1026881666 7:73910021-73910043 GGTGGGAGGCGGGTGGGGAAGGG + Intergenic
1028459273 7:91072329-91072351 AACTTGAGGAGGCTGGAGAACGG - Intronic
1028561334 7:92179293-92179315 CGCTGCAGGCGGGTGGAGAACGG + Intronic
1028954919 7:96677752-96677774 AAATGAAAGAGGGTGGGGAAGGG + Intronic
1029072908 7:97914303-97914325 ACCTGCAGGTGGGTGGGCAAGGG + Intergenic
1029704769 7:102270455-102270477 AACTGGAGGCTGCAGGGGACAGG - Intronic
1030060152 7:105615357-105615379 GGCTGGAGGCAGTTGGGGAACGG + Intronic
1031346210 7:120670578-120670600 AGCTGGAGGGAGGTGGGGCATGG - Intronic
1031656393 7:124361091-124361113 AACTTGAGGCGGGGTGGGCAGGG - Intergenic
1032159488 7:129499917-129499939 AAATGGAGGCTGCTGGGGGAAGG + Intergenic
1034241917 7:149617386-149617408 AGCAGGAGGCGGTTGGGGAGTGG + Intergenic
1034306348 7:150047918-150047940 ATCTGGAGCGGGGTGGGGAGTGG - Intergenic
1034652378 7:152701691-152701713 GACTGAAGAAGGGTGGGGAATGG - Intergenic
1034800499 7:154052735-154052757 ATCTGGAGCGGGGTGGGGAGTGG + Intronic
1035402138 7:158573248-158573270 AAATGGAGGGGGGATGGGAAAGG + Intronic
1035473962 7:159129199-159129221 AACTGGACTCTGGTGGGGACAGG + Intronic
1035473996 7:159129325-159129347 AACTGGACTCTGGTGGGGACAGG + Intronic
1036782320 8:11658242-11658264 AACAGGAGGAGAGTGGGGAGAGG + Intergenic
1036961715 8:13251293-13251315 AACTGCAGGCTGATGGGGCAGGG + Intronic
1037340920 8:17844102-17844124 AAGGGGAGAAGGGTGGGGAATGG - Intergenic
1037390652 8:18387893-18387915 AAGTGGAGGGGAGGGGGGAATGG - Intergenic
1037820576 8:22132918-22132940 AGCTGGGCGAGGGTGGGGAAGGG - Intronic
1037837360 8:22222001-22222023 TAGTGGAGGCGGCTGGGGGAGGG - Intronic
1038704083 8:29877847-29877869 AACTGGAGGCTGGAAGGGGAAGG + Intergenic
1039193387 8:35002502-35002524 AAGTGGAAGTGGGTGGGGAAAGG - Intergenic
1039750778 8:40476265-40476287 AACTGCAGATGGATGGGGAAGGG - Intergenic
1039976627 8:42372061-42372083 AACTGGGGGGGGGCGGGGCACGG + Intergenic
1041538765 8:58958978-58959000 AACTGGGAGTGGTTGGGGAATGG - Intronic
1041762246 8:61379373-61379395 AGATGGGGGAGGGTGGGGAAAGG - Intronic
1042821158 8:72931719-72931741 AACCTGAGGCAGGTGGGGCATGG + Intronic
1043959995 8:86406541-86406563 CACTGGAGGAGGCTGGTGAAGGG - Intronic
1044384711 8:91573780-91573802 AAGTGGAGGAGGGAGGGGGATGG + Intergenic
1046295713 8:112217311-112217333 AAGTGAGGGGGGGTGGGGAATGG - Intergenic
1049194063 8:141306012-141306034 TATTGGAGGGGGGTGGGGGAGGG - Intronic
1049403968 8:142443407-142443429 CACTGGAGGCAGGTGGGGGTAGG + Intergenic
1049415346 8:142492430-142492452 GTCTGGATGCGGGTGGGGAGGGG + Intronic
1050176228 9:2872024-2872046 GACTGGAGGCTGGCGGGGAGGGG + Intergenic
1051068625 9:13135647-13135669 GAATGGAAGCTGGTGGGGAAAGG - Intronic
1051161585 9:14214215-14214237 AAGAGCAGGCTGGTGGGGAAGGG - Intronic
1051681416 9:19611467-19611489 GAGAGGAGGCGGGAGGGGAAAGG + Intronic
1051722188 9:20048840-20048862 AATAGGATGGGGGTGGGGAAAGG - Intergenic
1051924228 9:22304304-22304326 AACTGGAGGGGAGGGGGAAATGG - Intergenic
1052720705 9:32168465-32168487 AATTGCAGGCAGGTGGGGGAAGG + Intergenic
1053433770 9:38061473-38061495 AAGTGGTGGCCTGTGGGGAATGG - Intronic
1053564419 9:39233287-39233309 GGCTGGAGGCGGGTGGGGTGGGG + Intronic
1053830200 9:42071188-42071210 GGCTGGAGGCGGGTGGGGTGGGG + Intronic
1054132731 9:61385749-61385771 GGCTGGAGGCGGGTGGGGTGGGG - Intergenic
1054600359 9:67116264-67116286 GGCTGGAGGCGGGTGGGGTGGGG - Intergenic
1054788097 9:69228837-69228859 AATTGTAGGGTGGTGGGGAAGGG - Intronic
1056331065 9:85521806-85521828 GACTCGAGGCAGGTGGGGAACGG + Intergenic
1057225205 9:93289343-93289365 CCCTGGAGTCGGATGGGGAAGGG + Exonic
1057311981 9:93948632-93948654 CGCAGGAGGCGTGTGGGGAACGG - Intergenic
1057498499 9:95578593-95578615 AACAGCAGGGGAGTGGGGAAGGG - Intergenic
1057996990 9:99828069-99828091 AACTGGAACCTGGAGGGGAAGGG - Exonic
1058084123 9:100731213-100731235 AGCTGGCGGCGGGTGTGGACTGG - Intergenic
1058474363 9:105316746-105316768 AACAGCAGGCTGGTGGGGAGAGG + Intronic
1058547209 9:106073429-106073451 AACTGGTGAGGAGTGGGGAAAGG - Intergenic
1058885271 9:109318329-109318351 CACTGGAGCCTGGTGGGGGAAGG - Intronic
1059336953 9:113575037-113575059 AAATGGAGGCGAGAGGAGAAGGG + Intronic
1060877003 9:127090704-127090726 AAATGGAGGCAGGAGGGGACTGG + Intronic
1062665774 9:137670699-137670721 AACTGGAGCCAGGAGGGGCAGGG - Intronic
1185484490 X:471998-472020 AATTGGAGGGGGGCGGGGATGGG + Intergenic
1185540483 X:899381-899403 AAGTGGAAGGGGATGGGGAAGGG - Intergenic
1185640646 X:1588136-1588158 AAGGGGAGGGGGGAGGGGAAGGG - Intergenic
1185640808 X:1588472-1588494 AAGGGGAGGGGGGAGGGGAAGGG - Intergenic
1185641041 X:1588966-1588988 AAGGGGAGGGGGGAGGGGAAGGG - Intergenic
1186421337 X:9429348-9429370 AACTAGAAGCTGGAGGGGAAGGG + Intergenic
1186720943 X:12303035-12303057 AACTGGAGGATGTTAGGGAAGGG + Intronic
1187090467 X:16090735-16090757 AAGTGGAGGTGTGTGGGTAAGGG - Intergenic
1187503200 X:19857121-19857143 GACTGGAGGCGGGGAGGGCAGGG + Intronic
1188993992 X:36859760-36859782 AAAAGGAGTCGGGAGGGGAAAGG - Intergenic
1190281635 X:48934925-48934947 AAATGGAGGCCTTTGGGGAAGGG - Intronic
1190708827 X:53050866-53050888 GACTGGAGTGGGGTGGGGGAGGG - Intronic
1190970388 X:55342563-55342585 TATTGGCGGCGGGTGGGGAGGGG - Intergenic
1193674878 X:84438041-84438063 AACTGGTGGCAGATGGGGGATGG + Intronic
1195212193 X:102660653-102660675 AACTGGCGGAGGGTGGAGGAGGG + Intergenic
1195218232 X:102721399-102721421 AACTGGCGGAGGGTGGAGGAGGG + Intronic
1195468682 X:105210008-105210030 GACTGGAGGAGGGGGAGGAAAGG - Intronic
1198254844 X:134915463-134915485 AAGGGGAGGCGGGAGGGGAGGGG - Intergenic
1202167718 Y:22010034-22010056 AATAGGTGGCAGGTGGGGAAGGG - Intergenic
1202169655 Y:22029193-22029215 AACAGGTGACGGGTGGGGAAAGG - Intergenic
1202221711 Y:22557180-22557202 AACAGGTGACGGGTGGGGAAAGG + Intergenic
1202223642 Y:22576335-22576357 AATAGGTGGCAGGTGGGGAAGGG + Intergenic
1202319474 Y:23619326-23619348 AATAGGTGGCAGGTGGGGAAGGG - Intergenic
1202321407 Y:23638494-23638516 AACAGGTGACGGGTGGGGAAAGG - Intergenic
1202549360 Y:26031562-26031584 AACAGGTGACGGGTGGGGAAAGG + Intergenic
1202551295 Y:26050731-26050753 AATAGGTGGCAGGTGGGGAAGGG + Intergenic