ID: 921380333

View in Genome Browser
Species Human (GRCh38)
Location 1:214518031-214518053
Sequence TACCAACGCATTGTTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921380333_921380338 25 Left 921380333 1:214518031-214518053 CCAGAAGGAACAATGCGTTGGTA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 921380338 1:214518079-214518101 TATTTATTTCACCTAGCACATGG 0: 1
1: 0
2: 1
3: 19
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921380333 Original CRISPR TACCAACGCATTGTTCCTTC TGG (reversed) Intronic
902098877 1:13968356-13968378 TTCCAAGGCACTGTTCCGTCTGG - Intergenic
903305023 1:22407227-22407249 TTTCAACGCATTATTCCTTGAGG - Intergenic
904159085 1:28509247-28509269 CACCAACACAGTGTGCCTTCTGG - Intronic
908108386 1:60870531-60870553 TTACAATGCATTGTTTCTTCTGG + Intronic
912268380 1:108183448-108183470 TACCAAACCATTGTTCCTACAGG + Intronic
917595430 1:176524571-176524593 TACCAAAGCCTTCCTCCTTCAGG - Intronic
919668757 1:200319401-200319423 CACCTACTCATTGTTCTTTCTGG - Intergenic
921380333 1:214518031-214518053 TACCAACGCATTGTTCCTTCTGG - Intronic
1068910914 10:62377073-62377095 TATCAAAGCCTTGTTCCTCCTGG - Intronic
1076891014 10:133283466-133283488 TACCAACAGATTCTGCCTTCAGG + Intronic
1080201015 11:29669915-29669937 TACCAAATCATTTGTCCTTCAGG - Intergenic
1080756448 11:35204552-35204574 TGCCAAACCACTGTTCCTTCTGG - Exonic
1080956848 11:37107531-37107553 TCCCCAAACATTGTTCCTTCAGG - Intergenic
1083159490 11:60846168-60846190 TCCCAACACCTTGTCCCTTCAGG + Intronic
1086007043 11:82049047-82049069 TACCAACGAATTTTTCCTTGTGG - Intergenic
1088378203 11:109164610-109164632 TACCAACAAATTGATCCATCAGG - Intergenic
1092312235 12:7370170-7370192 TGCCAAAGCATTGTTCATTTGGG - Intronic
1097487128 12:60217341-60217363 TTCTAACGCATTTTTCATTCTGG + Intergenic
1097610577 12:61814926-61814948 TAGCAGGGCTTTGTTCCTTCTGG - Intronic
1107164311 13:37267056-37267078 TACTAAGGCAGTGTTCCTTTGGG + Intergenic
1116486962 14:45461042-45461064 TACCAAATAATGGTTCCTTCAGG + Intergenic
1119437850 14:74609822-74609844 GTCCAAGGCATTGTTCCTGCTGG - Intronic
1122414498 14:101542442-101542464 TGGCAAGGCAGTGTTCCTTCTGG - Intergenic
1130221840 15:82026075-82026097 TAGCAAGGCAGTGTTCCTTCTGG + Intergenic
1130407273 15:83613077-83613099 TATCAATGCATTTTTCATTCTGG - Intronic
1130698741 15:86157574-86157596 TACCAACTCACTGTTCCATAAGG + Intronic
1130708593 15:86257012-86257034 TACCAACTTATTTTACCTTCAGG - Exonic
1133883859 16:9807712-9807734 CACCAAAGCAGTGTGCCTTCAGG + Intronic
1138596163 16:58030124-58030146 GACCAAAGCATTGCTCCTGCTGG - Intronic
1147312758 17:39605089-39605111 TACCAACGCCTTGGGCCTGCAGG + Exonic
1160020671 18:75178318-75178340 TACTGAGGCATTGTTCCTACAGG - Intergenic
1163917943 19:20259125-20259147 TACAAACACATTGTGCTTTCTGG + Intergenic
926548648 2:14273501-14273523 TACCATCGCATTGTACCTCTAGG + Intergenic
926928159 2:18009105-18009127 TACCAACTCCTTGTTCTTTGAGG - Intronic
927207999 2:20622071-20622093 TAAGAAGGCTTTGTTCCTTCTGG - Intronic
931742963 2:65265053-65265075 TACAAACACATTGTGCTTTCTGG + Exonic
932505450 2:72226011-72226033 TACCAACACACTGTTTCTTAGGG - Intronic
935116144 2:100138155-100138177 TACCACCGCAGTCTTCCTTCTGG + Intronic
937090332 2:119201959-119201981 TACCAAGCCGTTGTTCCCTCAGG + Intergenic
939910491 2:147977268-147977290 TAGCAAAGCTGTGTTCCTTCTGG - Intronic
939982391 2:148797155-148797177 TCCCAAAGCATTGTCCTTTCAGG + Intergenic
943084108 2:183291797-183291819 AAACAACGCATTGTTGGTTCAGG + Intergenic
1170032457 20:11957260-11957282 TGCCAAGGCTTTCTTCCTTCAGG - Intergenic
1170954878 20:20970624-20970646 TACCAACCCATTCATCCTTTGGG - Intergenic
1173830189 20:46078785-46078807 TCCCAATGTATTCTTCCTTCCGG - Intronic
1174135722 20:48377640-48377662 TACTAAGCCATTGCTCCTTCAGG + Intergenic
1181710910 22:24687807-24687829 TACAAACACATTGTGCTTTCTGG + Intergenic
1185266955 22:49909278-49909300 TACCAAAGCACCTTTCCTTCCGG + Exonic
952584660 3:34876737-34876759 TAAAAACTCATTGGTCCTTCTGG + Intergenic
956534720 3:70263173-70263195 AACCAACTGATTTTTCCTTCTGG + Intergenic
957038277 3:75315093-75315115 TTCCAAGGCTTTGTTCCTGCTGG + Intergenic
957511206 3:81190084-81190106 CACCAACGCTTTAATCCTTCGGG - Intergenic
958534210 3:95375981-95376003 TACAAATTCATTGTTACTTCTGG + Intergenic
960814503 3:121658954-121658976 TCCCAATGCATTGTTCCATGTGG - Intronic
963908073 3:150790571-150790593 TACCACCTCATAGTTCCTTCAGG - Intergenic
967779406 3:193419340-193419362 TGCCAAGGCATTGTTTCTTCAGG - Intronic
970208021 4:13675625-13675647 TAATAAAGCATTGTTCCATCTGG + Intergenic
970504759 4:16716494-16716516 TACTAAAGCATTGCTACTTCAGG - Intronic
972129734 4:35817071-35817093 TAACAAAGCATTATTTCTTCAGG - Intergenic
974310203 4:60197031-60197053 TACCACAGCATGGTACCTTCTGG - Intergenic
976262209 4:83156322-83156344 TACCAATACATTGTTTCATCTGG + Intergenic
977025725 4:91816887-91816909 TATCAACACATTGTTCATTTGGG + Intergenic
986902124 5:12449143-12449165 TAAAAAAGCATTTTTCCTTCAGG - Intergenic
989686054 5:44088713-44088735 TACCAACTCAAAGTTCCTGCAGG + Intergenic
996793228 5:127315978-127316000 TTCCCACACATTGTTCTTTCTGG + Intronic
998005776 5:138655927-138655949 TGCCCAACCATTGTTCCTTCTGG + Intronic
999718054 5:154377900-154377922 TACAAATGGGTTGTTCCTTCAGG - Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1018306022 6:162456644-162456666 TACTAAAGCATTGTTCCTAGGGG + Intronic
1019462992 7:1171183-1171205 TATTCACGCTTTGTTCCTTCTGG + Intergenic
1023421040 7:39979973-39979995 CACCAGAGCTTTGTTCCTTCTGG - Intronic
1034561552 7:151882997-151883019 TCCCAAAGCAGTGTTCCTGCTGG - Intergenic
1040293489 8:46137358-46137380 TGCCAACCCATTGTCTCTTCTGG + Intergenic
1042785959 8:72547110-72547132 AACAAATGCATTGTTCATTCAGG - Intronic
1043802087 8:84622071-84622093 TAGCAACTCATTGTGACTTCTGG - Intronic
1050981329 9:12019588-12019610 TACCACCTCAGTGTTCCTACAGG + Intergenic
1056449985 9:86707390-86707412 TACCAAAGCAGTCTTCCATCTGG - Intergenic
1194275910 X:91881785-91881807 TACAAATTCATTGTTCCTTAAGG + Intronic
1195056219 X:101147783-101147805 TACCAACTCATTTTTCTTTGCGG - Exonic
1195453980 X:105047270-105047292 TAGCAACTCATATTTCCTTCAGG + Intronic
1196929497 X:120667275-120667297 TACCAATGCACTGTTGCTTAAGG + Intergenic
1200593156 Y:5103222-5103244 TACAAATTCATTGTTCCTTAAGG + Intronic