ID: 921387373

View in Genome Browser
Species Human (GRCh38)
Location 1:214584236-214584258
Sequence CAAAGTGCTGCTAGTGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921387370_921387373 -9 Left 921387370 1:214584222-214584244 CCATGGAACCCATACAAAGTGCT 0: 2
1: 6
2: 38
3: 72
4: 258
Right 921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921387373 Original CRISPR CAAAGTGCTGCTAGTGATAC TGG Intergenic
No off target data available for this crispr