ID: 921388376

View in Genome Browser
Species Human (GRCh38)
Location 1:214594447-214594469
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921388376_921388377 7 Left 921388376 1:214594447-214594469 CCAGCGTCAGGGATGAAAGAGAG No data
Right 921388377 1:214594477-214594499 CATATTACAAGTCCATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921388376 Original CRISPR CTCTCTTTCATCCCTGACGC TGG (reversed) Intergenic
No off target data available for this crispr