ID: 921389656

View in Genome Browser
Species Human (GRCh38)
Location 1:214605758-214605780
Sequence CGCTGTGGGTGGAGGGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 11, 2: 4, 3: 28, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921389656_921389663 -8 Left 921389656 1:214605758-214605780 CCTGGTGCCCTCCACCCACAGCG 0: 1
1: 11
2: 4
3: 28
4: 273
Right 921389663 1:214605773-214605795 CCACAGCGGCTCCACCGCCTTGG 0: 6
1: 2
2: 4
3: 10
4: 260
921389656_921389664 -7 Left 921389656 1:214605758-214605780 CCTGGTGCCCTCCACCCACAGCG 0: 1
1: 11
2: 4
3: 28
4: 273
Right 921389664 1:214605774-214605796 CACAGCGGCTCCACCGCCTTGGG 0: 6
1: 2
2: 4
3: 4
4: 89
921389656_921389665 -6 Left 921389656 1:214605758-214605780 CCTGGTGCCCTCCACCCACAGCG 0: 1
1: 11
2: 4
3: 28
4: 273
Right 921389665 1:214605775-214605797 ACAGCGGCTCCACCGCCTTGGGG 0: 6
1: 2
2: 4
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921389656 Original CRISPR CGCTGTGGGTGGAGGGCACC AGG (reversed) Intronic
900366189 1:2312879-2312901 CGCTGTGGGTGGAGTAGACAGGG - Intergenic
900740581 1:4328529-4328551 CCGGGTGTGTGGAGGGCACCTGG + Intergenic
901663539 1:10813761-10813783 TGCTGTGGGAGCAGAGCACCTGG - Intergenic
902504080 1:16928245-16928267 CACAGTGGGTCAAGGGCACCTGG - Intronic
903043896 1:20552216-20552238 TGCTGTGGGTGAGGGGCAGCAGG + Intergenic
903759641 1:25689012-25689034 CGCAGTGGGTGGCTGGCACCTGG + Intronic
904676505 1:32202016-32202038 CGCTGTGGCTGGTAGGCACAGGG - Exonic
904896314 1:33820881-33820903 CGTGGTGGGGGGAGGTCACCAGG - Intronic
905209287 1:36362340-36362362 CAGTGTGGGTGCAGGGCTCCGGG + Intronic
905231479 1:36517186-36517208 TGCTGTGGGTGCAGGGGACGGGG + Intergenic
905767379 1:40612654-40612676 GGCTGTGGGAGGTGGGCACAGGG - Intergenic
906511747 1:46413972-46413994 TCCTGTGGGTGATGGGCACCAGG - Intergenic
907183403 1:52590306-52590328 AGCTGTGGGGGGAGGGGACCGGG + Intergenic
908783562 1:67713520-67713542 CACTCTGGGAGGAAGGCACCAGG + Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
911092785 1:94030946-94030968 CTCTGTGGGTTTGGGGCACCTGG - Intronic
912384404 1:109264097-109264119 TGCTGAGCGTGGAGGGCACAGGG + Exonic
912668052 1:111600661-111600683 AGCAGTGTGGGGAGGGCACCAGG + Intronic
914490878 1:148149460-148149482 CGCTGTGGGTGGAGGGCGCCGGG + Intronic
915341047 1:155177009-155177031 CGCTGTGGGTGCGCCGCACCCGG - Exonic
916714960 1:167440628-167440650 GGCTTTGGGAGGAGGGCACGGGG - Intronic
917860346 1:179137892-179137914 TGCTGTGGATGTAAGGCACCCGG - Intronic
918110350 1:181450235-181450257 CAATGTTGGGGGAGGGCACCTGG - Intronic
919743195 1:200992681-200992703 GGCTGTGGGTGAGGGCCACCAGG - Intronic
920397635 1:205658670-205658692 TGCTGTGGGCTGAGGGGACCTGG + Exonic
921375013 1:214464675-214464697 CGCTGTCGGTGGAAAGCACAGGG - Exonic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
922287503 1:224183133-224183155 CTCTCTGGGTGGAGGGCGCGTGG - Intronic
1063721275 10:8584089-8584111 GGCTGTGGGTGTAGGGGAGCAGG + Intergenic
1064597513 10:16960881-16960903 CCCTGTTGGTGAAGGGCCCCTGG - Intronic
1065101364 10:22335636-22335658 CGCTCCGGGTGGACGGCTCCGGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067972747 10:50991519-50991541 CGATGTGGGTCGAGGGCACTGGG - Intronic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1069594806 10:69663742-69663764 GGCAGAGGGTGGAGGGCAGCTGG - Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1074831795 10:117254671-117254693 AGCTGGGGGTGGAGGGGATCAGG + Intronic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1076106458 10:127827414-127827436 GGCTGAGGGTAGAGGGAACCAGG + Intergenic
1076798060 10:132808341-132808363 GGCTCTGGGTGGGGGGCTCCTGG - Intergenic
1076853206 10:133103089-133103111 CCCTGAGGGTGGAGGGTCCCGGG + Intronic
1077340896 11:2025879-2025901 CGCTGTGGGCGGCGGGCACCCGG - Intergenic
1077368245 11:2169915-2169937 AGCTGTGGGTGGAGGTCCCCGGG - Intronic
1077700030 11:4432532-4432554 GGCTGTGGGTGGTGGGCAAGTGG + Intergenic
1078057502 11:8019570-8019592 AGCTGTCGGAGGAGGGCACGCGG + Intronic
1080554429 11:33402902-33402924 CTCTGTGGGTGCAGGGTACAAGG - Intergenic
1081908819 11:46687035-46687057 GGATGTGGGTGGAAAGCACCTGG - Intronic
1081977517 11:47245082-47245104 AGCTCTGGGTGGAGAGCAGCAGG + Intronic
1082847905 11:57741326-57741348 CGCTTCGGGTGGAGGGGACAGGG - Intronic
1083140482 11:60717400-60717422 CCCTGTGGGTGGAGGGCTTGTGG - Intergenic
1083487423 11:62992340-62992362 TGCTGTGGCTGGAGGGAACCGGG + Intronic
1083798951 11:65035213-65035235 CGGGGTGGGAGGAGGGAACCAGG + Intronic
1084455427 11:69265429-69265451 AGCTGTGGGTGGTGGGGACCTGG + Intergenic
1084594376 11:70108265-70108287 TGCTGTGGCTGGAGAGGACCTGG - Intronic
1085037929 11:73310745-73310767 CGTCGTCGGCGGAGGGCACCTGG - Exonic
1088351343 11:108891832-108891854 CACTTTGTGGGGAGGGCACCGGG + Intronic
1089366699 11:117924957-117924979 CCCTGGGGGTGGGGGGCACGGGG + Intronic
1089422331 11:118341137-118341159 GGCTGTGGGTGGAGACCAGCTGG + Intronic
1089610117 11:119664339-119664361 CACTGGGGGTGGAGGGCTCAAGG - Exonic
1090255993 11:125284813-125284835 AGCTGGGGGTGGAGGACAGCAGG - Intronic
1090307239 11:125702101-125702123 TGCTGTCGGTGGGGGGCACGGGG + Intergenic
1091225652 11:133955547-133955569 CGCTGTGGGTGGGAGTCAGCAGG - Intronic
1202823881 11_KI270721v1_random:81068-81090 CGCTGTGGGCGGCGGGCACCCGG - Intergenic
1094141457 12:27186188-27186210 TGCTGTGGGTGGAGTGCTCATGG + Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1096627921 12:52906588-52906610 TGCTGTGGGTGGAAGGCAGGAGG + Intronic
1096769265 12:53923745-53923767 GGCTGTGGGAGGGGAGCACCAGG - Intergenic
1098002109 12:65955769-65955791 TTCTGTGGGTGGTGTGCACCCGG + Intronic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1103446999 12:121001123-121001145 CGCTGTGGTTGGATGGCAGCAGG - Exonic
1104440689 12:128791122-128791144 CCCTGGGGGTGGGGGGCACGAGG + Intergenic
1104655160 12:130568925-130568947 GGCTGTGTGAGGAGGGCACGTGG - Intronic
1104969814 12:132526192-132526214 GCCTGTGGGTGGAGGGCAGGCGG + Intronic
1105585901 13:21742525-21742547 GGCTGGAGGTGGAGGGCACATGG - Intergenic
1105745965 13:23377123-23377145 GGCTGTGGGGGGAGGGAACGAGG + Intronic
1113393548 13:109920910-109920932 AGCTGTGGGTGATGGACACCTGG - Intergenic
1113848419 13:113404890-113404912 CGGCGTGGGGAGAGGGCACCAGG - Intergenic
1113906561 13:113822058-113822080 CCCTGGAGGTGGACGGCACCAGG - Exonic
1113922624 13:113922425-113922447 ATCTCTGGGTGCAGGGCACCTGG - Intergenic
1119420967 14:74507945-74507967 GGCTCTGGGGGGAGGGCACAGGG - Intronic
1119421037 14:74508238-74508260 GGCTGTGGGAGGTGGGCACCGGG + Intronic
1119673377 14:76536734-76536756 GAGTGTGGGTGTAGGGCACCGGG - Intergenic
1119679784 14:76583978-76584000 AGCTGCGGGTTGAGGGCCCCTGG + Intergenic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1122075225 14:99231308-99231330 CGCGGTGGGGGGCGGGCCCCCGG - Intronic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122721274 14:103723921-103723943 CGCTGAGGGTGGCGGGGACATGG + Intronic
1122902107 14:104786252-104786274 CCCACTGGGTGGAGGGCACTTGG - Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1123076478 14:105669794-105669816 CGCTCCTGGAGGAGGGCACCAGG + Intergenic
1123739818 15:23225954-23225976 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1124291043 15:28454927-28454949 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1124537470 15:30558526-30558548 CACTGTGGGTGGCTGGCAACGGG - Intronic
1124761186 15:32449061-32449083 CACTGTGGGTGGCTGGCAACGGG + Intronic
1124777448 15:32600002-32600024 CACTGTGGGTGGCTGGCAACGGG - Intronic
1126823479 15:52528231-52528253 CGCTGGGGGTGGCGAGCCCCGGG - Intronic
1127923756 15:63517658-63517680 CCCTCTGGGAGGTGGGCACCTGG + Intronic
1129740839 15:77988835-77988857 CGCAGTGGGTGGTGGGGCCCTGG + Intronic
1129844885 15:78763705-78763727 CGCAGTGGGTGGTGGGGCCCTGG - Exonic
1130467975 15:84202234-84202256 CGGTGAGGGTGCTGGGCACCGGG + Intergenic
1130496291 15:84471308-84471330 CGGTGAGGGTGCTGGGCACCGGG - Intergenic
1130590267 15:85206832-85206854 CGGTGAGGGTGCTGGGCACCGGG + Intergenic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132629228 16:908812-908834 ACCTGTGGATGGCGGGCACCGGG - Intronic
1136110698 16:28062571-28062593 CGATGGGGGTGGAAGGCTCCCGG + Intronic
1136417774 16:30114001-30114023 AGCTGGGAGTGAAGGGCACCAGG + Intergenic
1136707719 16:32202716-32202738 CGCTGTGGGTGGAGGGCGCCGGG + Intergenic
1136760190 16:32726694-32726716 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1136807914 16:33143692-33143714 CGCTGTGGGTGGAGGGCGCCGGG + Intergenic
1138205082 16:55118774-55118796 GGCAGGGGGTGGAGGGGACCAGG - Intergenic
1139850757 16:69950651-69950673 GGGTGAGGGTGGTGGGCACCGGG + Intergenic
1139879741 16:70173563-70173585 TGGTGAGGGTGGTGGGCACCGGG + Intronic
1140372783 16:74421985-74422007 GGGTGAGGGTGGTGGGCACCGGG - Intergenic
1141428602 16:83959322-83959344 GGGTGTGGGTGGATGGCATCTGG - Exonic
1141638409 16:85327942-85327964 ATCTGGGGGTGGGGGGCACCAGG - Intergenic
1141964777 16:87434462-87434484 CGCTGGGTCTGGAGGCCACCTGG + Intronic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142200692 16:88759884-88759906 AGCTGTGTGGGGAGGGGACCTGG + Intronic
1142406361 16:89892372-89892394 TGCTGGGGGTGGAGGGCGGCGGG + Intronic
1203062345 16_KI270728v1_random:987016-987038 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1142480342 17:215027-215049 CCCGGGGTGTGGAGGGCACCCGG - Intronic
1144783659 17:17820170-17820192 CTCTGTGGCAGGAGGGCCCCTGG + Exonic
1145191499 17:20844155-20844177 CGCTGTGGGTGGAGGGCGCCGGG + Intronic
1145898118 17:28472523-28472545 AGCTCTGGGTGAAAGGCACCAGG - Intronic
1146063131 17:29617419-29617441 CCCTGCGGGTGGGGGGCGCCTGG + Intronic
1146086879 17:29838244-29838266 CCCAGTGTGTGGAGGGGACCAGG - Intronic
1146538448 17:33673659-33673681 CGCTGTGGGTGCAGGGGACTGGG - Intronic
1147240612 17:39088121-39088143 TGCAGTGGGAGGGGGGCACCTGG - Intronic
1148463540 17:47851351-47851373 CCCTGGGAGTGGAGGGGACCAGG - Intronic
1148491021 17:48024095-48024117 CGCTGGGGGTGGAGGGCCGCCGG - Intergenic
1148894576 17:50832505-50832527 AGCCGTGGGAGGAGGTCACCAGG - Intergenic
1151509491 17:74549590-74549612 GGCAGAAGGTGGAGGGCACCTGG - Intergenic
1151871834 17:76841783-76841805 CCCAGTGGGTCCAGGGCACCTGG + Intergenic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1152065887 17:78112362-78112384 GGCTGTGGGGGGTGGGCACAGGG - Exonic
1152544412 17:80993472-80993494 CTCCGTGGGTGGAGGGAACCGGG + Intronic
1152644863 17:81464060-81464082 CGCTGTGGGTGGGGCGGGCCGGG - Exonic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1153767704 18:8389836-8389858 GGCTGTGGGTGGAGAGTTCCCGG + Intronic
1155147558 18:23096768-23096790 CTCAGTGAGTGGAGGGAACCAGG + Intergenic
1156457787 18:37304461-37304483 GGCAGTGGGTGGAGGTAACCTGG + Intronic
1160698499 19:495716-495738 CGCTGGGGATGGAGGCCCCCTGG - Intronic
1160933956 19:1584521-1584543 CGCTGTGCGTTGAGCTCACCTGG + Exonic
1160985641 19:1837354-1837376 GGCTGTGCATGGAGGGCCCCGGG - Intronic
1160994708 19:1877284-1877306 CGCTGTGGGTGGAGGGCGCCGGG - Exonic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234493 19:3191094-3191116 CGCGGTGCGTGGCGGGCAGCAGG + Intronic
1161393566 19:4033345-4033367 AGCTGGGGGTGAGGGGCACCGGG + Intronic
1161736221 19:5993824-5993846 CGCTGGGGGTGGGGTGCTCCGGG + Exonic
1163362675 19:16857651-16857673 TGATGTGGGTGGTGGGCACATGG - Intronic
1163765745 19:19162449-19162471 CCTGGTGGGTGGAGAGCACCCGG - Intronic
1164825531 19:31282455-31282477 CTCTGTGGGTGAAGGCCACCAGG + Intronic
1165596113 19:37012238-37012260 CGCGGCGGTAGGAGGGCACCTGG - Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1165832695 19:38737117-38737139 AGCTGAGGCTGGAGGGAACCCGG - Intronic
1166738672 19:45101237-45101259 AGCAGTGGGAGGAGTGCACCAGG + Intronic
1166752212 19:45169740-45169762 CGCTGTGGGAGGAGGTGACACGG - Intronic
1167095418 19:47372803-47372825 CGCTGCGGGTGAAGGGCGACTGG - Exonic
1167159267 19:47756623-47756645 TGCTGTGGGGCGAGGGCATCTGG + Intronic
1167461100 19:49625197-49625219 TGCTGTGGGTGGGGCTCACCTGG - Exonic
1168288756 19:55347089-55347111 CGTGGTGGGTGGAGAGCACTGGG - Exonic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925844056 2:8020049-8020071 CACTGTCTGTGGAGGGCTCCCGG + Intergenic
925907421 2:8547726-8547748 GGGTGTTGGAGGAGGGCACCAGG - Intergenic
926128141 2:10284440-10284462 CACTGTGGGTGGGGGGAACTTGG + Intergenic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
926758154 2:16252414-16252436 TGCTGTGGTTGGAGGCCCCCGGG + Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
929236069 2:39606916-39606938 TCCTGTGGGTTGTGGGCACCTGG + Intergenic
929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG + Intergenic
929938952 2:46315773-46315795 CTCTGAGGGTGGAGGGCAAGAGG + Intronic
931395998 2:61888769-61888791 CGCTGTGGGTGAAGAGCGCCGGG + Exonic
932423130 2:71612976-71612998 AGCTCTGGGTGGGGGGCACCAGG + Intronic
936154854 2:110040917-110040939 GGCTCTGCGTGGTGGGCACCAGG - Intergenic
936189828 2:110330497-110330519 GGCTCTGCGTGGTGGGCACCAGG + Intergenic
937306501 2:120874820-120874842 AGCTGGGGGTGGAGGGTACTCGG + Intronic
938765727 2:134459635-134459657 GGCTGGGGGAGGAGGGAACCCGG - Intronic
938777050 2:134551068-134551090 GGCTGGGGGTGGGGGTCACCAGG + Intronic
947499150 2:230659620-230659642 CGCAGTGGCTGGTGGGCACCTGG + Intergenic
948588107 2:239033964-239033986 GGCTGGGGCTGGAGGCCACCTGG + Intergenic
948835159 2:240622844-240622866 GGCTGGGGGCGGAGGGCCCCGGG + Intronic
948936180 2:241166468-241166490 CTGTGTGGGCGGTGGGCACCAGG + Intronic
1172101057 20:32484041-32484063 GGCTGGGGGGAGAGGGCACCCGG + Intronic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1174076775 20:47942843-47942865 CGCTGTGTGTCGAGGGCATGTGG + Intergenic
1174082746 20:47982820-47982842 CGCAGTGGGTGGTGGGCAGGGGG - Intergenic
1175887833 20:62302556-62302578 GGCTGTGGGCGGCGGGCACCAGG - Intronic
1176107217 20:63395125-63395147 CTCTGAGGGTGGAGAGCACACGG - Intergenic
1179802496 21:43817481-43817503 CTATGTGGGAGGAGGGCGCCAGG - Intergenic
1179908808 21:44437435-44437457 GGCTGCGGCTGGAGGCCACCTGG + Intronic
1179937455 21:44614359-44614381 CACTGTGGCTGGAGGGAGCCCGG + Intronic
1180197770 21:46207833-46207855 CAATGGGGGTGGGGGGCACCTGG - Intronic
1181120796 22:20667902-20667924 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1181180917 22:21067794-21067816 GGATGTGGGTGTACGGCACCAGG - Intergenic
1181306515 22:21920226-21920248 CGCTGTGGGTGCAGGTGAGCCGG - Exonic
1181333758 22:22114928-22114950 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1182420201 22:30245275-30245297 CCCTCTGGCTGGAAGGCACCAGG + Intronic
1182481646 22:30613059-30613081 CGCTGGGGGTGGGGAGCAGCTGG + Intronic
1183086702 22:35491392-35491414 GGATAGGGGTGGAGGGCACCTGG - Intergenic
1183098753 22:35570573-35570595 GGCTGTTAGTGGAGGGCCCCTGG + Intergenic
1183750958 22:39720021-39720043 CACTGTGGTTGGAGGGGACTGGG + Intergenic
1184206583 22:43007867-43007889 ATCTGTGGGTGGAAGGCAACAGG - Intronic
1184407175 22:44306811-44306833 CGGCGTGTGTGGAGGGGACCTGG + Intronic
1184863570 22:47190506-47190528 CGCTGGGTGGGGAGGGCTCCTGG - Intergenic
1185083698 22:48724396-48724418 CTCTGTGAGTGGAGGGTCCCAGG - Intronic
1185128060 22:49022719-49022741 GGCTGTGGCTGGGGGGAACCAGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
949392898 3:3582520-3582542 TGGTGAGGGTGTAGGGCACCAGG - Intergenic
949538190 3:5011954-5011976 GGCGGTGGGTGGAGGCCACGAGG + Intergenic
950265296 3:11568864-11568886 CGCTGAGGCTGCACGGCACCCGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
954025851 3:47782304-47782326 CGCTGGGGGTGGAGGGCCTGAGG - Intergenic
954035474 3:47848835-47848857 AGCAGTGGGTGGACGGCTCCAGG - Intronic
954557948 3:51532997-51533019 GGCAGTGGCTGGAGGGAACCTGG + Intergenic
955321891 3:57980458-57980480 AGCTGTGGGTGGAGGGTTTCAGG - Intergenic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
960914276 3:122680906-122680928 CGCTGCTGGTCGAGGGCTCCTGG + Exonic
961355816 3:126339369-126339391 GGCTGTAGTGGGAGGGCACCAGG - Intergenic
962200609 3:133398599-133398621 CTCTCTGGGTGGTGGGCAACAGG + Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
966855766 3:184193032-184193054 AGGTGTGGCTGGAGGGCACAGGG + Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
967055188 3:185824590-185824612 AGCTGTGGGGGGAGGGGAGCGGG + Intronic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
968522383 4:1039869-1039891 CCCTGTGGAGGGTGGGCACCCGG + Intergenic
968556399 4:1248374-1248396 CGCTGTGGGGGAAGGGGACGGGG - Intronic
968758428 4:2428526-2428548 CGCTGTGGGTGGAGGGGTGGGGG - Intronic
968805460 4:2768936-2768958 GGCTGTGGGGGGAGGGGATCTGG - Intergenic
968819411 4:2838237-2838259 CACTGTGAGGGGAGGGCACTTGG - Exonic
968909255 4:3469312-3469334 TGGGCTGGGTGGAGGGCACCGGG - Intronic
969608307 4:8213097-8213119 CCTTGTGGGTGGAGGGCAGGTGG - Intronic
975423818 4:74202560-74202582 TGCTGTGGGAGGAGGGCACAAGG + Intronic
980929969 4:139176405-139176427 CGCTCTGGGTGGCGGGCAGGCGG - Intronic
982080158 4:151781754-151781776 TGCTGAGGCTGGAGGGCACAGGG + Intergenic
982284776 4:153723975-153723997 CTCTTTGGGTGGAGGGGACATGG - Intronic
984850761 4:184150548-184150570 GGCTGAGGCTGGAGGGAACCAGG + Intronic
984973284 4:185209484-185209506 CGCTGTGGGTGGGCGCCTCCCGG + Intronic
985504979 5:273683-273705 CGCTGTGGGTGGGGGGGTGCTGG + Intronic
985644901 5:1080263-1080285 CGCCGTGGGTGGAGGGCGTGGGG - Intronic
985644916 5:1080318-1080340 CGCCGTGGGTGGAGGGCGTGGGG - Intronic
987286876 5:16465909-16465931 CGCTGTGGCTGAAAGGGACCTGG + Intergenic
987332148 5:16866869-16866891 GGCTGTGGGTGGAGACCAGCAGG - Intronic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988992707 5:36687059-36687081 GGCTGTGTGTGGTGGTCACCAGG + Exonic
990410274 5:55534815-55534837 GGCTGTGAGGGGAGGGCCCCGGG - Exonic
995675653 5:114659697-114659719 CGCTGTGGGGGGATAGCACTAGG + Intergenic
998134011 5:139665328-139665350 CGCTGTGGTTTAGGGGCACCGGG + Intronic
999389582 5:151180481-151180503 CCCTGTATGTGGAGGGGACCTGG + Intergenic
999742721 5:154568825-154568847 CGGGCTGTGTGGAGGGCACCTGG - Intergenic
1001171073 5:169419501-169419523 AGCTGTGGATGAAGGGCACTCGG + Intergenic
1002051451 5:176573927-176573949 GGCTGCGGGTGGAAGGCACCTGG - Intronic
1002169118 5:177365718-177365740 GGCTGGGGGAGGAGGGAACCAGG + Intronic
1005164896 6:22908535-22908557 GACTATGGGTGGAGGGCAGCAGG + Intergenic
1005997126 6:30938324-30938346 CGCTGTGGGTGGAAGAGACCTGG - Intergenic
1006991961 6:38222598-38222620 CATTGTGAGGGGAGGGCACCAGG + Intronic
1007416669 6:41694981-41695003 GGCTGTGGGTGGACAGCAGCAGG - Intronic
1008092855 6:47309762-47309784 CGCTGTCGGAGGAGAGCACCCGG - Exonic
1009417939 6:63436525-63436547 AGCTGGGGGTGGAGGGTTCCTGG - Intergenic
1013298447 6:108781048-108781070 TGGAGTGGGTGGAGGGCGCCTGG - Intergenic
1015721747 6:136249937-136249959 CGCTGTGTTTGGAGAGCACCAGG - Intronic
1017039150 6:150293996-150294018 CATTGTGGGTGGAAGGGACCTGG + Intergenic
1017780804 6:157713894-157713916 CGCTGTGGGTGCAAAGAACCTGG - Intronic
1019033645 6:169035193-169035215 TGATGTGGGCGGAGGGCAGCAGG - Intergenic
1020005741 7:4783088-4783110 CGCTGAGGCTGGAGGGGGCCTGG - Intronic
1021789747 7:24192904-24192926 TGCTAGGGGTGAAGGGCACCAGG + Intergenic
1024294193 7:47829903-47829925 AGCTGTGGTTGGAGAGAACCAGG - Intronic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1029207444 7:98878289-98878311 CCCTGGGGGCGGTGGGCACCTGG - Intronic
1029252564 7:99247532-99247554 CGCTGGGGGAAGAGGGTACCAGG + Intergenic
1029382281 7:100221867-100221889 AGCTGTGGAAGGAGGGCATCAGG - Intronic
1029402439 7:100354316-100354338 AGCTGTGGAAGGAGGGCATCAGG - Intronic
1033229981 7:139589030-139589052 TTCTGTGGGTGGAGGACCCCAGG + Intronic
1033390729 7:140924846-140924868 CGCCGCGGGCGGAGGGCGCCTGG + Intergenic
1036620171 8:10419739-10419761 CTCTTTGGGTGGAGGGCAGGCGG + Intronic
1037542832 8:19888794-19888816 AGCTGTGGGTGGAGAGGAGCTGG - Intergenic
1038796564 8:30715579-30715601 AGGTGTGGGTGGAAGGCACGGGG - Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040850959 8:51899636-51899658 AGCTGAGGCTGGAGGGCGCCTGG - Intergenic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1043668544 8:82849880-82849902 GGAGATGGGTGGAGGGCACCTGG + Intergenic
1048355873 8:133653725-133653747 GGGTGTGGGTGCAGGGCACAGGG + Intergenic
1048860302 8:138719894-138719916 CCCTGTGGGTGGAGGGCGGGAGG + Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049342926 8:142123432-142123454 TGCTGGCGGTGGGGGGCACCTGG + Intergenic
1049410539 8:142471982-142472004 CGCTGTGGGTGCCTGGGACCTGG + Intronic
1049715135 8:144086232-144086254 CGCTGTCCGTGTAGGGCCCCAGG + Intergenic
1049748530 8:144273053-144273075 CGCTGCTTGTGGAGGGCGCCCGG - Intronic
1051959611 9:22742642-22742664 GGCTGTGAGTGGAAGTCACCTGG - Intergenic
1053428246 9:38025209-38025231 CTCTGTGGGAGGTGGGCTCCGGG + Intronic
1059423475 9:114206687-114206709 CACTCTTTGTGGAGGGCACCTGG + Intronic
1059646785 9:116275928-116275950 TGCTGGGGGATGAGGGCACCAGG - Intronic
1061488822 9:130934110-130934132 CTCTGTGGGTTGAGGGGACTGGG + Intronic
1062059678 9:134488381-134488403 TGCAGTGGGTGGCGGTCACCTGG + Intergenic
1062278902 9:135743348-135743370 CGCTGAAGGTGGATGGCAGCGGG - Intronic
1062537597 9:137027765-137027787 CGCTGTGGGCGGGGGGCAAGCGG - Exonic
1062554608 9:137108258-137108280 AGCTCAGGGTGGAGGGCGCCTGG - Intronic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1192146542 X:68686503-68686525 CGTGGGGTGTGGAGGGCACCCGG + Intronic
1192210793 X:69126572-69126594 CACTGTGGGTGGGGGGCAGGGGG - Intergenic
1192554623 X:72079934-72079956 GGCTGTGGGTGGAGTGCAGCGGG + Intergenic
1194005845 X:88491020-88491042 TGCTGAGGGTGGGGGGCTCCAGG + Intergenic
1195078326 X:101348424-101348446 CGGGGTGGGGGGCGGGCACCTGG - Intronic
1196708355 X:118737199-118737221 AGCTGTGGGCAGAGGGCTCCAGG + Intronic
1198005474 X:132489321-132489343 GGCTGTGGGAGGAGGGGACAAGG + Intronic
1199071319 X:143478352-143478374 TGCTGTGGGTGGAGAGAACATGG - Intergenic
1202368210 Y:24180893-24180915 CGGTGAGGGTGCTGGGCACCGGG - Intergenic
1202372487 Y:24208289-24208311 CGGTGAGGGTGCTGGGCACCGGG + Intergenic
1202498298 Y:25461831-25461853 CGGTGAGGGTGCTGGGCACCGGG - Intergenic
1202502575 Y:25489224-25489246 CGGTGAGGGTGCTGGGCACCGGG + Intergenic