ID: 921391512

View in Genome Browser
Species Human (GRCh38)
Location 1:214619531-214619553
Sequence TAGTCGTGATGCTCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921391506_921391512 21 Left 921391506 1:214619487-214619509 CCTAGCGATCAGGGCTATTCTTG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 921391512 1:214619531-214619553 TAGTCGTGATGCTCCCTGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921391512 Original CRISPR TAGTCGTGATGCTCCCTGCC TGG Intronic
901685032 1:10939026-10939048 TACTCCTGATCCTCCCTCCCTGG + Intergenic
901752715 1:11421260-11421282 TAGGCGTGAGCCACCCTGCCTGG + Intergenic
903614029 1:24639035-24639057 TAGTCGTGAGCCACCATGCCTGG - Intronic
904498584 1:30901378-30901400 CAGCCGAGATGCTCCCTGGCTGG + Intronic
909231333 1:73093959-73093981 TGGTCATGATGCTCCCTCCATGG + Intergenic
911062099 1:93757537-93757559 GAGTCGTGATGCTCGCTGAAGGG - Intronic
914774119 1:150720336-150720358 TAGGCGTGAAGCACCGTGCCCGG + Intronic
915746852 1:158167648-158167670 TAGGCGTGAGGCACCATGCCTGG + Intergenic
917040570 1:170801697-170801719 TAGGCGTGAGCCACCCTGCCCGG + Intergenic
919024585 1:192150811-192150833 TAGTCGTGAGCCACCGTGCCTGG - Intergenic
919945643 1:202317621-202317643 TAGTCGTGAGCCACCATGCCTGG + Intronic
920072922 1:203316034-203316056 TAGGCGTGAGCCTCCATGCCTGG - Intergenic
921391512 1:214619531-214619553 TAGTCGTGATGCTCCCTGCCTGG + Intronic
924521559 1:244810467-244810489 CAGTCGTGAGGCTCCACGCCCGG - Intergenic
924753573 1:246920806-246920828 TAGGCGTGAGGCACCGTGCCTGG - Intronic
1064466552 10:15588337-15588359 TAGTGGCGATGCTCCATTCCAGG - Intronic
1068865803 10:61894811-61894833 TAGGCGTGAGGCACCATGCCTGG - Intergenic
1071770697 10:88726407-88726429 TAGGTGTGAGCCTCCCTGCCTGG - Intronic
1072088580 10:92104661-92104683 TAGTCGTGAGGCACCACGCCCGG + Intronic
1072139481 10:92576859-92576881 TAGGCGTGAGCCTCCATGCCCGG + Intergenic
1072416851 10:95254637-95254659 TAGTCGTGAGCCACCGTGCCTGG - Intronic
1074388888 10:113040057-113040079 TACTCTGGAGGCTCCCTGCCTGG - Exonic
1081130254 11:39370839-39370861 TAGGCGTGATCCACCTTGCCCGG - Intergenic
1085618286 11:78018427-78018449 TAGGCGTGAGGCACCATGCCCGG - Intronic
1088785464 11:113177727-113177749 AAGACATGATGCTCTCTGCCAGG - Intronic
1089496604 11:118911299-118911321 CACTCCTGATGCTCCCTGCGGGG + Intronic
1092454462 12:8630443-8630465 CAGTCGTGAGCCTCCATGCCTGG - Intergenic
1097850662 12:64406651-64406673 TAGGCGTGAGCCACCCTGCCTGG + Intronic
1102196624 12:111030055-111030077 TAGTTGTTTTTCTCCCTGCCTGG + Intergenic
1105374623 13:19832133-19832155 CAGGCGTGAGGCACCCTGCCTGG + Intronic
1105643486 13:22290896-22290918 TAGGCGTGAGCCACCCTGCCCGG - Intergenic
1106689175 13:32095618-32095640 TAGGCGTGAGCCACCCTGCCTGG + Intronic
1106922428 13:34577710-34577732 TAGGCGTGAGCCACCCTGCCAGG - Intergenic
1114132742 14:19811521-19811543 TAGGCGTGAGCCACCCTGCCTGG + Intronic
1116169553 14:41382531-41382553 CAGTCGTGAGGCACCATGCCTGG - Intergenic
1116881186 14:50170833-50170855 TAGGCGTGAGCCACCCTGCCTGG - Intronic
1118802002 14:69198964-69198986 TAGGCGTGAGCCTCCATGCCCGG - Intronic
1119341624 14:73883761-73883783 CAGTCGTGAGGCCCCATGCCCGG + Intronic
1121658048 14:95612790-95612812 TAGGCGTGAGGCACCATGCCTGG - Intergenic
1121763745 14:96467615-96467637 TAGGCGTGAGCCACCCTGCCCGG + Intronic
1124832078 15:33158907-33158929 TAGTCATGAGGCACCATGCCTGG - Intronic
1126450460 15:48802972-48802994 TAGTCCTGATTTTCACTGCCTGG - Intronic
1132492845 16:243254-243276 TAGGCGTGAACCACCCTGCCCGG + Intronic
1132750018 16:1453288-1453310 TAGTCGTGAGGCACCGCGCCCGG + Intronic
1135740860 16:24974151-24974173 TAGGCGTGAGCCTCCGTGCCTGG - Intronic
1138715180 16:59012943-59012965 TAGGCGTGAGCCTCCGTGCCTGG + Intergenic
1139608046 16:68034043-68034065 TAGGCGTGAGGCACCTTGCCTGG + Intronic
1142182981 16:88680560-88680582 TAGGCGTGAGCCTCCATGCCTGG + Intronic
1144020912 17:11240114-11240136 TAGTGGTGATACTCGCAGCCAGG - Intergenic
1144777678 17:17793007-17793029 TAGGCGTGATGTTTCCTGCGAGG - Exonic
1147040583 17:37715352-37715374 TAGACGTGATGCTCCTTGTCTGG - Intronic
1147871912 17:43593448-43593470 TAGGCGTGAGCCACCCTGCCCGG - Intergenic
1151482195 17:74376807-74376829 TAGGCGTGAGCCACCCTGCCTGG + Intergenic
1152471733 17:80493287-80493309 ACTTCGTGATGCTGCCTGCCTGG + Intergenic
1155143166 18:23061617-23061639 TAGTCGTGAACCACCGTGCCTGG + Intergenic
1156016613 18:32553763-32553785 TATTTGTGATCCTCCTTGCCTGG + Intergenic
1157026070 18:43845378-43845400 TAGGCGTGATCCACCATGCCCGG + Intergenic
1160715126 19:572961-572983 TGGGCGTGAAGCTCCCTGCTTGG + Intronic
1162413761 19:10521571-10521593 TAGGCGTGAGCCACCCTGCCCGG + Intergenic
1162929480 19:13950143-13950165 CAGTCGTGATCCACCATGCCTGG + Intronic
1163013288 19:14438970-14438992 TAGGCGTGAGGCACCGTGCCCGG + Intronic
1163305925 19:16478828-16478850 TAGGCGTGAGGCACACTGCCTGG + Intergenic
1164894511 19:31860717-31860739 TAGTCGTGAGCCACCATGCCTGG - Intergenic
1165084083 19:33330658-33330680 TAGGCGTGAGCCTCCTTGCCCGG - Intergenic
1165714256 19:38034410-38034432 GAGTGGTGAAGCTGCCTGCCAGG + Intronic
1166778368 19:45326177-45326199 CAGGCGTGAGGCACCCTGCCGGG + Intergenic
1168659285 19:58153971-58153993 CAGGCGTGATCCACCCTGCCTGG + Intronic
925200784 2:1966115-1966137 CAGAGGTGATGCTTCCTGCCAGG - Intronic
927622382 2:24675605-24675627 TAGGCGTGATGCACCGCGCCCGG - Intronic
927670104 2:25061771-25061793 TAGGCGTGAGCCACCCTGCCTGG + Intronic
932771507 2:74503171-74503193 TGGGCGTGATTCTCCCTCCCTGG + Intronic
933773601 2:85758828-85758850 GAGTGGGGCTGCTCCCTGCCAGG + Intronic
935030661 2:99318449-99318471 TAGGCGTGAGGCACCGTGCCCGG + Intronic
940765167 2:157782453-157782475 TAGTCTTTATGTTCCTTGCCTGG + Intronic
942300051 2:174552451-174552473 GAGTGCTGATGCTCCCTGGCCGG + Intergenic
944123294 2:196265205-196265227 TAGGCGTGAGCCACCCTGCCTGG - Intronic
945299462 2:208202142-208202164 TAGGCATGAGGCTCCGTGCCTGG + Intergenic
946217405 2:218195402-218195424 TAGTCGTGAGCCACCATGCCTGG - Intergenic
947562860 2:231173084-231173106 TAGGCGTGAGCCACCCTGCCTGG - Intergenic
947969043 2:234306597-234306619 TAGCACTGCTGCTCCCTGCCTGG - Intergenic
949039091 2:241837720-241837742 TAGCTGCAATGCTCCCTGCCTGG + Intergenic
1169336723 20:4762841-4762863 TAGGCGTGATCCACCGTGCCTGG - Intergenic
1175500705 20:59448520-59448542 TGGTGGTGAGGCTCCCTGCCTGG + Intergenic
1181130594 22:20729312-20729334 TAGCCGTGCAGCTGCCTGCCAGG - Exonic
1182225095 22:28791567-28791589 TAGACGTGAAGCACCGTGCCTGG + Intergenic
1182801023 22:33031929-33031951 CAGGCGTGATCCTCCATGCCTGG - Intronic
1184494652 22:44831416-44831438 TAGGCGTGAGCCACCCTGCCTGG - Intronic
1184801830 22:46765742-46765764 TAGGCGTGAGCCTCCATGCCTGG + Intronic
1185025718 22:48410697-48410719 TGGTGATGATTCTCCCTGCCAGG + Intergenic
953162536 3:40434513-40434535 TAGGCGTGAGCCTCCATGCCTGG - Intergenic
953640543 3:44703116-44703138 TAATCATGTTGCTCTCTGCCTGG - Intergenic
957616062 3:82528986-82529008 TAGTCATGAGCCACCCTGCCTGG + Intergenic
959751664 3:109844098-109844120 CAGTCGTGATCCACCGTGCCTGG - Intergenic
959760668 3:109960033-109960055 CAGGCGTGATCCACCCTGCCTGG + Intergenic
961763247 3:129187322-129187344 TAGGCGTGATCCACCGTGCCCGG - Intergenic
963639524 3:147841154-147841176 TAATTGTTATGCTCCCTGACTGG + Intergenic
965580198 3:170259529-170259551 TAGGCGTGAAGCACCGTGCCTGG - Intronic
966159779 3:176955593-176955615 CAGGCGTGAGGCTCCGTGCCTGG - Intergenic
966192795 3:177286640-177286662 TAGGCGTGAGCCACCCTGCCTGG + Intergenic
966622282 3:181978462-181978484 TAGTCGTGAGCCACCATGCCCGG + Intergenic
966744477 3:183262849-183262871 TTGTGGTGACGCTGCCTGCCTGG + Intronic
966793823 3:183696053-183696075 TTCTCTTGTTGCTCCCTGCCTGG - Intergenic
967538314 3:190633636-190633658 TAGTCGTGAGCCACCATGCCCGG + Intronic
967721390 3:192819953-192819975 TAGTCCTGGTGCTCCCTACAAGG + Intronic
968159102 3:196410544-196410566 TAGGCGTGAGCCTCCGTGCCTGG - Intronic
968453948 4:687925-687947 GAGTCGTCATGGTCTCTGCCTGG - Intronic
968639087 4:1701627-1701649 TAGGCGTGATCCACCTTGCCTGG - Intronic
969217540 4:5734361-5734383 TAGTCGTGAGCCACCATGCCTGG - Intronic
972271125 4:37511510-37511532 TAGTCGTGAGGCTCCCATTCCGG - Intronic
972507713 4:39736183-39736205 TAGACGTGAGGCACCGTGCCCGG - Intronic
977687060 4:99859191-99859213 TAGTTGTGAGCCTCCGTGCCTGG + Intronic
980948574 4:139348174-139348196 TAGTCGTGAGTCACCGTGCCCGG - Intronic
981213856 4:142139582-142139604 CAGTCGTGAGCCACCCTGCCCGG + Intronic
982739311 4:159041201-159041223 TAGTGGTGCTATTCCCTGCCGGG + Intergenic
983773447 4:171577849-171577871 ATTTGGTGATGCTCCCTGCCTGG + Intergenic
984326941 4:178267266-178267288 TAGGCGTGAGGCACCATGCCTGG + Intergenic
987571527 5:19668747-19668769 TTGTCATGATGTTCCCTGACTGG + Intronic
987595938 5:19999320-19999342 TAGGCGTGAGTCACCCTGCCCGG - Intronic
990314156 5:54568396-54568418 TAGATGTTCTGCTCCCTGCCAGG + Intergenic
990966011 5:61448923-61448945 TAGTTGTAATGCTGCCTGCAAGG + Intronic
992050622 5:72937215-72937237 TAGTCGTGATGGTGGCTACCAGG - Intergenic
995823939 5:116271538-116271560 TAGTCGTCATGCTCTCAGTCTGG - Intronic
998059649 5:139109891-139109913 TAGACGTGAGCCTCCGTGCCTGG - Intronic
998092075 5:139377273-139377295 TATTCCTGATGCTCCCTGCAGGG + Intronic
998121308 5:139580340-139580362 CAGTCGTGAGTCACCCTGCCTGG + Intronic
1001483015 5:172101597-172101619 TTGTTGTCAAGCTCCCTGCCCGG - Intronic
1001930571 5:175670033-175670055 GAGCAGTGATGCCCCCTGCCTGG - Intronic
1002452031 5:179324666-179324688 TAGGCGTGAGGCACCATGCCTGG + Intronic
1003565052 6:7215615-7215637 TAGGCGTGAGCCACCCTGCCTGG + Intronic
1004976584 6:20973880-20973902 TAGGCGTGAGCCACCCTGCCTGG + Intronic
1005973215 6:30777707-30777729 TAGGCGTGAGCCACCCTGCCTGG - Intergenic
1007808452 6:44469290-44469312 ATGTAGTGATGCTCACTGCCAGG - Intergenic
1008403546 6:51093136-51093158 TAGGCGTGATCCACCCTGCCTGG - Intergenic
1008570526 6:52812191-52812213 TAGTCGTGATGCTCCTTCCACGG + Intergenic
1008642117 6:53474745-53474767 TAGTCTAGATGCTCCCTCCATGG + Intergenic
1012502627 6:99906212-99906234 TAGGCGTGAGCCACCCTGCCCGG - Intergenic
1015246027 6:131075676-131075698 TAGGCGTGATCCACCGTGCCTGG - Intergenic
1016381659 6:143490396-143490418 TAGGCCTGAAGCTCACTGCCAGG + Intergenic
1017216801 6:151917683-151917705 CATTCTTGATGCTCCCTGCCTGG + Intronic
1018897975 6:168034534-168034556 TAGGCATGAGTCTCCCTGCCTGG + Intronic
1019739038 7:2663718-2663740 TGGCCGTGAGGCTGCCTGCCAGG + Exonic
1020950682 7:14672667-14672689 TAGTCGTGCTGCTACTTACCAGG - Intronic
1021864491 7:24941385-24941407 TACTCCTGCTGCTCCCTGCCAGG + Intronic
1022858652 7:34342368-34342390 TAGACGTGAGCCACCCTGCCTGG + Intergenic
1023039019 7:36156042-36156064 TATTTGTGATGGTCCCTTCCAGG + Intronic
1026290728 7:69003395-69003417 TAGGCGTGCTCCACCCTGCCTGG - Intergenic
1028712764 7:93928664-93928686 TAGGCGTGAGCCACCCTGCCCGG - Intergenic
1031614727 7:123867060-123867082 TAGGCGTGAGCCACCCTGCCTGG + Intronic
1034206051 7:149316443-149316465 TAGGCGTGAGGCACCGTGCCTGG + Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1038444458 8:27593690-27593712 TAGTCGTGAGCCACCGTGCCTGG + Intergenic
1042362853 8:67902280-67902302 TATTCCTGCTGCTCCCTTCCTGG + Intergenic
1042600119 8:70490978-70491000 TAGTCGTGAGCCACCATGCCTGG + Intergenic
1044991806 8:97802921-97802943 TAGGCGTGAGGCACCGTGCCTGG - Intronic
1045980706 8:108184066-108184088 TAGTTATTATGCTCCCTACCTGG + Intergenic
1046246519 8:111570209-111570231 GAGTCGTGATCATCCCTGGCTGG - Intergenic
1047262910 8:123278165-123278187 CAGGCGTGAGGCACCCTGCCTGG - Intergenic
1047596418 8:126382073-126382095 TATTCCTAATCCTCCCTGCCTGG - Intergenic
1048962301 8:139590688-139590710 TAGGCGTGAGCCACCCTGCCCGG - Intergenic
1060170947 9:121460568-121460590 TAGGCGTGATCCACCATGCCTGG - Intergenic
1060224060 9:121780753-121780775 CCGTCCTGCTGCTCCCTGCCTGG - Intronic
1194999626 X:100630383-100630405 TATTCGTGAGGTTCCCTGGCAGG - Intronic
1200834600 Y:7721063-7721085 TACTGTTTATGCTCCCTGCCAGG + Intergenic