ID: 921393041

View in Genome Browser
Species Human (GRCh38)
Location 1:214636435-214636457
Sequence CAGTTTAGCAGCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921393037_921393041 16 Left 921393037 1:214636396-214636418 CCCTTTAGTTCTGATTGATATCT 0: 1
1: 0
2: 2
3: 38
4: 357
Right 921393041 1:214636435-214636457 CAGTTTAGCAGCAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 265
921393038_921393041 15 Left 921393038 1:214636397-214636419 CCTTTAGTTCTGATTGATATCTT 0: 1
1: 0
2: 1
3: 35
4: 316
Right 921393041 1:214636435-214636457 CAGTTTAGCAGCAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921393041 Original CRISPR CAGTTTAGCAGCAGGGAAGC AGG Intronic
900184740 1:1327785-1327807 CAGATCTGCAGCAGGAAAGCCGG - Exonic
900242357 1:1623241-1623263 CAGTCTGGCACCAGGGAGGCCGG - Intronic
900805979 1:4768763-4768785 CACTTTAGCACCTGAGAAGCTGG - Intronic
900951316 1:5859626-5859648 CAGCTTCGCAGCAGAGACGCAGG + Intergenic
902204173 1:14855159-14855181 CAGTTTAGCAGGTTGGAAACGGG - Intronic
903169149 1:21541430-21541452 CAGCTCAGCAGCAGTGAAGATGG - Intronic
903256649 1:22106745-22106767 CAGTTTAGCTGCAGGGTCTCAGG - Intergenic
904542834 1:31245039-31245061 CAGTTTATCAGCAGTATAGCTGG - Intergenic
905227969 1:36492443-36492465 CAGCTGAGCACCAGGGAAGCAGG - Intergenic
905307559 1:37030058-37030080 CAGTTGAGAAGGAGGAAAGCTGG + Intronic
905807104 1:40884869-40884891 CAGTTTAGCAGGTGGGCATCAGG + Intergenic
906146056 1:43561317-43561339 CAGGTTTGGAGCAGGGAAGGAGG - Intronic
907250267 1:53133467-53133489 CTGCTCAGCAGCAGGGAGGCTGG + Intronic
908215929 1:61951922-61951944 CCGTTTCTCAGCAGGAAAGCTGG + Intronic
909743172 1:79058122-79058144 CAGTTTAGCAGCATATAAACTGG - Intergenic
911099730 1:94085740-94085762 CACTGTGGCAGCAGAGAAGCAGG - Intronic
913585206 1:120268034-120268056 CAGTTGAGCTGCAGTGATGCTGG - Intergenic
913622979 1:120630328-120630350 CAGTTGAGCTGCAGTGATGCTGG + Intergenic
914567208 1:148879895-148879917 CAGTTGAGCTGCAGTGATGCTGG - Intronic
914605615 1:149250347-149250369 CAGTTGAGCTGCAGTGATGCTGG + Intergenic
915645056 1:157264584-157264606 AAGTTAAGCAGGAGGGAGGCAGG + Intergenic
916721036 1:167484929-167484951 CAGTCTGGCAGCAGAGCAGCAGG - Intronic
917531742 1:175842038-175842060 CAGGTTGGCAGAAGGGAGGCAGG + Intergenic
918226017 1:182484148-182484170 TAGTTCAGCTACAGGGAAGCAGG + Intronic
920030731 1:203035991-203036013 CATTTTAGCAACTGAGAAGCTGG - Intronic
921328795 1:214014955-214014977 AAGTTTATCAGCAGCGAAGAGGG + Intronic
921393041 1:214636435-214636457 CAGTTTAGCAGCAGGGAAGCAGG + Intronic
921720574 1:218466208-218466230 CAGTTTCCCAGCTGGGAAGATGG + Intergenic
923365021 1:233251049-233251071 AAGTATATTAGCAGGGAAGCAGG - Intronic
923916838 1:238516552-238516574 TGGTTTGGCAGCAGGGAAGTAGG - Intergenic
924736712 1:246763653-246763675 CAGTTTAGTAGGAGGAAAGGGGG - Intronic
1062884313 10:1004815-1004837 CAGTTTAGCCTCAGGGATGAAGG + Intronic
1063458243 10:6200337-6200359 CAGGTTAGTAGGAGGGAAGTTGG + Intronic
1064392586 10:14954436-14954458 CAGGCTAGCAGCAGACAAGCAGG - Intergenic
1067164194 10:43852306-43852328 CAGCTAGGAAGCAGGGAAGCCGG - Intergenic
1067531754 10:47079210-47079232 CCCTTTAGCAGCAGGGCTGCTGG + Intergenic
1069747363 10:70724308-70724330 GAGGTGAGGAGCAGGGAAGCTGG + Intronic
1069775958 10:70927330-70927352 CTGATAAGCAGCAGGGAAGCTGG - Intergenic
1070817618 10:79335331-79335353 CAGTCTGGCAGCAGAGAGGCAGG + Intergenic
1071345211 10:84685662-84685684 TAGCTTAGAAGCAAGGAAGCTGG + Intergenic
1071907560 10:90190758-90190780 CAGTAAAGGAGTAGGGAAGCAGG + Intergenic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074937917 10:118204428-118204450 CACTTTAGCTGCAGAGTAGCTGG - Intergenic
1075950979 10:126477610-126477632 CATGTTAGCATTAGGGAAGCAGG + Intronic
1076493694 10:130882448-130882470 AGCTTTGGCAGCAGGGAAGCAGG - Intergenic
1077367116 11:2165756-2165778 CAGTACAGCTGCGGGGAAGCCGG + Exonic
1077616189 11:3675786-3675808 CAGGGTAGGAGTAGGGAAGCTGG + Exonic
1078569078 11:12442090-12442112 CAGTTCAGCAGCATGGAGGCAGG + Intronic
1078663815 11:13308006-13308028 AAGAGTAGCAGCAGGGAAGCAGG + Intronic
1083359618 11:62097031-62097053 CAGTTTAGCAGCAGGGGGGGTGG + Intergenic
1083359817 11:62098824-62098846 CAGTTTAGCAGCAGGGGGGGTGG - Intergenic
1083477533 11:62923714-62923736 CGATTTAGCCGCAGGGAGGCTGG + Intergenic
1083758069 11:64801984-64802006 CAGATGACCAGCAGGGAGGCGGG - Intronic
1089236064 11:117026779-117026801 CAGCTTAGCAGCTGGAGAGCTGG - Intronic
1089302318 11:117506036-117506058 CCGAGGAGCAGCAGGGAAGCTGG - Intronic
1089650947 11:119912491-119912513 CAGTTGAGTAGCAGAGTAGCAGG + Intergenic
1090596106 11:128322893-128322915 CAGACTAGAAGAAGGGAAGCAGG + Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1095310773 12:40693717-40693739 CGGCTCAGCAGCAGGGAAGCCGG - Intronic
1095538519 12:43280285-43280307 GAGTTGAGCAGCAGGTGAGCGGG - Intergenic
1095979832 12:47965686-47965708 CAGTTAAGAAGCAGTGAAGCAGG - Intronic
1096150351 12:49306111-49306133 CTGTTGAGCAGAAAGGAAGCAGG - Intergenic
1097584875 12:61503393-61503415 GAGGTGAGCAGCAGGCAAGCAGG + Intergenic
1098897501 12:76080900-76080922 CAGTTTCCCACCAGGGGAGCTGG + Intronic
1100203750 12:92326321-92326343 AAGTTGAGGAGCAAGGAAGCCGG + Intergenic
1101239587 12:102824699-102824721 CGGTTTAGCAGAAGGTAGGCGGG - Intergenic
1101805026 12:108056156-108056178 CACTTGAGCAGCAAGGGAGCTGG - Intergenic
1103644266 12:122378457-122378479 GAGTTTAGCAGCATTGAAGATGG - Intronic
1103835909 12:123820881-123820903 CATTTTGGCCGCAGGGAAGGGGG + Intronic
1104903083 12:132199514-132199536 CACTTGAGCAGCAGGGACGACGG + Intronic
1106087115 13:26553240-26553262 AAATCTAGCAGCAGGGAAACTGG - Intergenic
1106281387 13:28275748-28275770 CAGAATGGCAGGAGGGAAGCTGG - Intronic
1107479046 13:40770219-40770241 CAGGTTAGTAGCAGTGAAGATGG - Intronic
1108621945 13:52193457-52193479 CAGATTAGTAGCAGTGAAGATGG - Intergenic
1108664752 13:52618455-52618477 CAGGTTAGTAGCAGTGAAGATGG + Intergenic
1109932711 13:69235936-69235958 CAGTTTAACAGGGAGGAAGCTGG - Intergenic
1109997587 13:70149665-70149687 CAGATTAGCAGTAGGCAATCTGG + Intergenic
1110953418 13:81522480-81522502 AAGTTTGGCAACAGGGTAGCTGG + Intergenic
1112361110 13:98719470-98719492 AAGTAAAGCAGCAGTGAAGCAGG + Intronic
1114979682 14:28147423-28147445 CAGTATAGGAGGATGGAAGCAGG - Intergenic
1115151304 14:30289070-30289092 CAATTTTGCAGCAGGGGAGGAGG - Intergenic
1119435723 14:74596646-74596668 CAGAGAGGCAGCAGGGAAGCAGG + Intronic
1119639539 14:76304412-76304434 CAGTTCATCAGCTGGGAAACTGG - Intergenic
1120769054 14:88358700-88358722 CAGCTCAGCATCAGAGAAGCAGG + Intergenic
1122429192 14:101629209-101629231 CAGGTCAGCAGCAAGGAAGTAGG + Intergenic
1123097615 14:105773869-105773891 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123097632 14:105773948-105773970 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1124868146 15:33514313-33514335 CAGATGAGCAGCAGAGAAACGGG - Intronic
1125103488 15:35943197-35943219 CAGTTTATCAGCAGGAAGGACGG + Intergenic
1127403136 15:58612420-58612442 TAGTCTAGCTCCAGGGAAGCAGG - Intronic
1128814571 15:70598452-70598474 CAGCTTGGCAGAAGGGAAGAGGG - Intergenic
1129504728 15:76071799-76071821 AGGTCTTGCAGCAGGGAAGCGGG - Intronic
1129733127 15:77943121-77943143 CGGAGCAGCAGCAGGGAAGCCGG - Intergenic
1130680397 15:85991418-85991440 CAGTCCAACAGCAGGGAATCAGG + Intergenic
1131790173 15:95956019-95956041 CAATTTGGCTGCAGCGAAGCTGG + Intergenic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1132683075 16:1151863-1151885 CGGGTGAGCAGCAGAGAAGCAGG - Intergenic
1133957342 16:10456229-10456251 CTGTTTAGCAGAAAGGAACCAGG + Intronic
1134051727 16:11142079-11142101 CAGGTTCACAGCAGGGAGGCAGG + Intronic
1138036021 16:53607100-53607122 CAGCTAAGCAGTAGGAAAGCAGG - Intronic
1138497507 16:57417103-57417125 CAGTTTGGCGGCAGGGGCGCGGG + Intergenic
1138672194 16:58624416-58624438 CAGTTAAGCAACAGGTATGCTGG + Intronic
1139283035 16:65786075-65786097 AATTTTAGCAACAAGGAAGCGGG + Intergenic
1141340340 16:83197922-83197944 CAGTTTAACATTAGGGAAACTGG + Intronic
1141903491 16:87007706-87007728 CAGTTGGGCCCCAGGGAAGCAGG - Intergenic
1142008420 16:87701300-87701322 CAGGTTAGCAAGAGGGTAGCAGG + Intronic
1142692185 17:1613307-1613329 CAGCTGAGCTCCAGGGAAGCCGG + Intronic
1142798626 17:2329323-2329345 CAGGTTAGCAATGGGGAAGCTGG - Exonic
1143025917 17:3941981-3942003 CCGAGTAGCACCAGGGAAGCAGG - Intronic
1146252582 17:31362311-31362333 AGGTTTATCAGCGGGGAAGCAGG - Intronic
1147053213 17:37813712-37813734 CAGTCTGGCTGCAGAGAAGCTGG - Intergenic
1147357958 17:39912294-39912316 GAGTTGGGCAGCAGGGAAGGAGG - Intronic
1147568427 17:41552038-41552060 CAGTTTCCCATCTGGGAAGCTGG + Intergenic
1148334055 17:46829845-46829867 CAGCTCAGCAGCAGGGAGCCAGG - Intronic
1148643528 17:49205834-49205856 CTGGTTAGCAGAAGGGAGGCTGG - Intronic
1149772076 17:59330653-59330675 CAGTTTCCCAGCAGGAAAACAGG - Intergenic
1151130438 17:71891179-71891201 CAGTTAACTAGCGGGGAAGCAGG - Intergenic
1151641330 17:75397004-75397026 CTGAGTAGCAGCAGGAAAGCAGG - Intronic
1152687564 17:81702044-81702066 CAGCTGAGAAGCAGAGAAGCTGG - Exonic
1152987001 18:330257-330279 CAGCTGAGCAGCAGGGAGGAGGG - Intronic
1154147687 18:11879869-11879891 CAGTTTAGCATCTGCTAAGCAGG - Intronic
1154233379 18:12579464-12579486 AAGGTTAGCAGCAGGAGAGCAGG + Intronic
1156453233 18:37278513-37278535 CAGTTGTGGAGCAGGGGAGCGGG - Intronic
1157496365 18:48160391-48160413 CAGTATAACAGCAGGCACGCTGG + Intronic
1159238128 18:65704343-65704365 CAGTGTAGCAACAGGAAATCAGG - Intergenic
1160098674 18:75900752-75900774 CAGGTTAGCAGCATGGTAGGAGG - Intergenic
1160192321 18:76724145-76724167 CTGTTGAGCAGCAGGAAAGGGGG - Intergenic
1160422589 18:78757288-78757310 CAGTTTAGCAACAGTGAGGCTGG - Intergenic
1162424012 19:10583180-10583202 CAGTGAGGAAGCAGGGAAGCTGG + Intronic
1164405480 19:27941678-27941700 CAGTTTTACAGTAGGGAAGGAGG + Intergenic
1164742874 19:30589717-30589739 CAGTGGAGCAGCAAGGAAGCTGG + Intronic
1164876512 19:31694338-31694360 AACTTCAGCAGGAGGGAAGCAGG + Intergenic
1165210418 19:34231350-34231372 CAGTTTTGCAGGATGGAATCAGG + Intergenic
1165422287 19:35728182-35728204 CTGGGTAGCAGAAGGGAAGCCGG + Intronic
1166074399 19:40405322-40405344 CTATTTTGCAGCAGGGAAGTGGG - Intronic
1166192880 19:41187164-41187186 CTGGTTTGCAGCAGAGAAGCAGG - Intergenic
1166741975 19:45119928-45119950 CAGTGAAGCAGCCGGGAACCAGG - Intronic
1167564834 19:50249635-50249657 GAGTTCAGCTGCAGGGACGCAGG - Exonic
1168232825 19:55044194-55044216 CAGTTTATCACCAGGGCAACAGG - Intronic
925438470 2:3862982-3863004 CAGGTGAGCAGCAGGCAAGTGGG + Intergenic
926287181 2:11498651-11498673 CAGTTTTGCTGCTGGGCAGCTGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926423607 2:12721270-12721292 CAGTTTTTCAGCAGTGGAGCAGG + Intronic
927815713 2:26215472-26215494 CAGTTTTGCAGCAAGAATGCAGG - Intronic
928876551 2:36046783-36046805 CTGTTTTGCATCAGGCAAGCAGG + Intergenic
929194110 2:39167145-39167167 CTCTTTTGCAGCAGGGGAGCTGG + Intergenic
929924102 2:46195168-46195190 TAGTCTAGCAGCAGGGCTGCTGG + Intergenic
930029451 2:47049362-47049384 CAGTATAGCAGCAGGGATCTGGG + Intronic
930193006 2:48479481-48479503 CAGTTTTGCAGAGGGCAAGCAGG + Intronic
930275961 2:49311438-49311460 CAGTGTAGCAGCATAGAAGCAGG + Intergenic
930691684 2:54371564-54371586 GAGTTTTCCAGCAGGGAGGCTGG + Intronic
930953487 2:57174266-57174288 GAATTTATCAGCAGGCAAGCAGG - Intergenic
931655047 2:64503110-64503132 CAGTTCAGGTGCAGGGAGGCTGG + Intergenic
931975592 2:67640611-67640633 TAGCTTAGCAGCAGGGAAGTGGG + Intergenic
933121313 2:78541791-78541813 TTGTTTAGCAGCTGGGAGGCGGG + Intergenic
933992199 2:87641781-87641803 CATTTTTGCAGCATGGAAGTCGG - Intergenic
934066092 2:88343318-88343340 CCTTTGAGCAGCAGGGAAGTGGG + Intergenic
936301650 2:111309056-111309078 CATTTTTGCAGCATGGAAGTCGG + Intergenic
938729324 2:134134080-134134102 ACTTTTAGCAACAGGGAAGCGGG + Intronic
939328889 2:140732446-140732468 CATTTTAGGAGCAGAGAAACAGG + Intronic
939734249 2:145824195-145824217 TAGTTTAGCAACAGGTCAGCAGG + Intergenic
940340838 2:152579221-152579243 AAATTTAGCAGCAAGGATGCTGG - Intronic
941859759 2:170266877-170266899 CAGTTTTCCAGAAGGGAAACTGG + Intronic
942713470 2:178864582-178864604 CTGTTAAACAGGAGGGAAGCAGG - Intronic
944751093 2:202710701-202710723 AAGGTTAGCAGCAGGCAAGAAGG - Intronic
945681152 2:212916117-212916139 GTGTTCAGCAGCAGGGAAGCAGG - Intergenic
947469751 2:230390129-230390151 CAGTTTAGCTTGAGGGAAGGAGG + Intronic
1168866083 20:1087828-1087850 GAGCTTTGCAGCAGAGAAGCAGG + Intergenic
1169297203 20:4410479-4410501 CACTTAAGCAGCGAGGAAGCTGG - Intergenic
1169725542 20:8725133-8725155 CTGTTTCCCAGAAGGGAAGCAGG + Intronic
1170463289 20:16599265-16599287 CAGTTTGGCTGCAGGTAAGTAGG + Intergenic
1170787853 20:19482922-19482944 CAGCTTAGCAGATGGGAAGGTGG + Intronic
1172427290 20:34863754-34863776 CAGCTGGGCAGCAGGGAGGCTGG + Intronic
1173150197 20:40560751-40560773 CACTTTTGCAGCAGGGAAAAGGG - Intergenic
1175555219 20:59848108-59848130 CAGTATACCAGGAGGGAAGGAGG - Intergenic
1175583087 20:60115884-60115906 GCGTTTAGCAACAGGAAAGCAGG + Intergenic
1179180782 21:39043088-39043110 GAGGTTTGCAGCAGGCAAGCTGG - Intergenic
1179397624 21:41056119-41056141 CAGCTCAGAAGCAGGGAGGCTGG + Intergenic
1182021050 22:27081817-27081839 CAGTTGAGCACCAGTGAGGCAGG - Intergenic
1182525899 22:30918933-30918955 CAGGTGAGCTGCAGGCAAGCAGG + Intergenic
1185229339 22:49671127-49671149 CAGGGTAGCAGCAGGGACGTGGG + Intergenic
949228902 3:1727285-1727307 CAGTTTTGCTTCAGGGAAGAAGG - Intergenic
949852948 3:8437160-8437182 CAGTCTACCAACAGGAAAGCAGG + Intergenic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
950138260 3:10598288-10598310 CAGTTTGGAAGCAGAGAAACTGG - Intronic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
955201304 3:56854554-56854576 CAAGTTAGCAGCAGGAATGCAGG + Intronic
955335757 3:58084397-58084419 CACATTAACAACAGGGAAGCCGG - Intronic
957842004 3:85684411-85684433 AGGTTTAGCAGTAGGCAAGCCGG + Intronic
960950351 3:122995005-122995027 GTGTTTAGCAGGAGGGAAGCCGG + Intronic
961049658 3:123735526-123735548 ACGTTCAGCACCAGGGAAGCTGG - Intronic
961418617 3:126781561-126781583 CAGTTGAGCAGCTGGGCATCAGG + Intronic
962876146 3:139537605-139537627 CAGACTACCAGCAGAGAAGCTGG + Intronic
963047599 3:141114332-141114354 CAGGTCAGCTGCAGGGGAGCTGG - Intronic
963273744 3:143310124-143310146 CAGTTCAGCAGCACTGCAGCAGG - Intronic
963948451 3:151171548-151171570 GGTTTTAGCAGCAGGGAAGGAGG - Intronic
966563734 3:181352422-181352444 CAGGTGAGCGGCAGGTAAGCGGG - Intergenic
966600774 3:181773091-181773113 CAGTATAGCAGCAGGAAAACAGG + Intergenic
966870376 3:184286456-184286478 GAGGGGAGCAGCAGGGAAGCGGG + Intronic
972511415 4:39771167-39771189 CCGTGTAGCAGGAGAGAAGCAGG + Intronic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
978555266 4:109973028-109973050 CTGGTTTGCAGCAGGGAAACAGG + Intronic
978743751 4:112167709-112167731 CAGTTTAATAGCAGGGAACATGG + Intronic
980244684 4:130223981-130224003 TAGTCTAGCTTCAGGGAAGCAGG + Intergenic
985521924 5:377776-377798 AAGTCCAGCAGCAGGGAACCAGG - Intronic
986290685 5:6396829-6396851 CACATCAGCAGCAGGCAAGCAGG + Intergenic
986505484 5:8445696-8445718 CAGGCTAGCAGCAGGGAACAGGG + Intergenic
986640450 5:9867220-9867242 CAGATTCCCAGCAGGAAAGCAGG - Intergenic
988413684 5:30918516-30918538 AAGTTGAGGAGCAAGGAAGCCGG + Intergenic
989608673 5:43270858-43270880 CAGTTGAGCAACTGGGAGGCTGG - Intronic
991414053 5:66373365-66373387 AAGTTTAGCAGCAGGGGAGGGGG - Intergenic
991487672 5:67154937-67154959 TGGTTTAACAGCAGGGAAGTTGG + Intronic
992008081 5:72499284-72499306 CAGTGATGCAGCAGGCAAGCAGG - Intronic
993598510 5:89889912-89889934 CAGTTTAGCTGCTGAGATGCAGG + Intergenic
993746129 5:91599218-91599240 CAGTTCACCAGCAGAGAAGATGG - Intergenic
994220657 5:97191639-97191661 CAGATTAGCAGCAGGTATTCAGG - Intergenic
994478937 5:100308508-100308530 AAGTTTGGCAGCAGGAAACCTGG - Intergenic
998005021 5:138651118-138651140 GAGAGGAGCAGCAGGGAAGCTGG - Intronic
999428144 5:151505049-151505071 GAGGTGAGCAGCAGGGGAGCGGG - Exonic
999858560 5:155620975-155620997 CAGTCTGGCAGCAGGGAGGGAGG + Intergenic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001315281 5:170637344-170637366 CAGGGCAGAAGCAGGGAAGCTGG - Intronic
1002330576 5:178437699-178437721 CAGGTGAGCAGCAGGGAAGTAGG - Intronic
1002543211 5:179919966-179919988 CTGTTCTGCACCAGGGAAGCTGG - Intronic
1002876268 6:1213092-1213114 CACTGCACCAGCAGGGAAGCTGG + Intergenic
1003544809 6:7051100-7051122 CGGATTGGCAACAGGGAAGCAGG - Intergenic
1005173464 6:23015191-23015213 CAGTTTGCCAGCAGTGAAGTAGG + Intergenic
1005266044 6:24113193-24113215 CAGGTGAGCAGCAGGTATGCAGG - Intergenic
1005875185 6:30006137-30006159 CAGGTAAGCAGCGGGGAAGCAGG + Intergenic
1006038214 6:31230622-31230644 CAGTTTATCAGCTGTGCAGCTGG + Intergenic
1006502628 6:34468096-34468118 CAGGTCAACATCAGGGAAGCTGG + Intronic
1006885845 6:37381551-37381573 TACTTGAGCAGCAGGGAAGTGGG + Intronic
1007220657 6:40276227-40276249 CAGCTTAGCACCAGGCACGCGGG + Intergenic
1007776454 6:44226966-44226988 CAGTTTATAAGCTGGGAAACAGG - Intronic
1007843272 6:44734041-44734063 CCTTTTAGCAGCAGGGTGGCTGG - Intergenic
1011656630 6:89557686-89557708 GAGGTGAGCAGCAGGCAAGCAGG + Intronic
1012600140 6:101086499-101086521 AAGTCTAGCAGGAAGGAAGCAGG + Intergenic
1013078617 6:106792950-106792972 GAATGTAGCAGCAGGGCAGCAGG + Intergenic
1013356609 6:109350900-109350922 CAGTGGAGAAGCAGGTAAGCTGG - Intergenic
1018425128 6:163672835-163672857 CTGTTAAGCAGCAGGTGAGCAGG + Intergenic
1019934120 7:4243149-4243171 CAGAGTTGCAGCAAGGAAGCAGG - Intronic
1021605222 7:22403110-22403132 CAGTTTAGTAGCTGAGGAGCAGG + Intergenic
1024350193 7:48355644-48355666 CAGTGTGGTAGCAGAGAAGCTGG + Intronic
1024365691 7:48517765-48517787 CATATAAGCAGCAGGGAATCAGG - Intronic
1025825471 7:65007272-65007294 CAGCTTAGCAGAAGGGAGGGAGG - Intergenic
1026419278 7:70216643-70216665 CACTTAAGAAGCAAGGAAGCTGG - Intronic
1028551421 7:92071272-92071294 CAGTTTAGCAGGAGTGTAGAGGG + Intronic
1029464729 7:100718122-100718144 CAGGTGAGCAGAAGGGAAGATGG - Intergenic
1030266768 7:107629476-107629498 ATGTTTAGCAGCAGGCATGCAGG - Intergenic
1032197166 7:129796110-129796132 CATTTTAGCAGCAGGGACTGAGG - Intergenic
1032999007 7:137482284-137482306 GAGATAAGCAGCAGGGAAGCTGG - Intronic
1035573429 8:688673-688695 GAGTTAAGCAGCAGAGAAGTGGG + Intronic
1036545766 8:9768215-9768237 CAGTGCAGCCCCAGGGAAGCAGG + Intronic
1039119468 8:34129744-34129766 CATTTTAGAAGCAAGGAGGCAGG - Intergenic
1042746067 8:72107361-72107383 CAGATAAGCAACAGAGAAGCAGG - Intronic
1043486241 8:80701789-80701811 GAAATTAGCAGCAAGGAAGCAGG + Intronic
1044800418 8:95948291-95948313 GAGTTGGGCAGGAGGGAAGCAGG - Intergenic
1045093844 8:98776332-98776354 CAGGTTTGCTGCAGGGAAGCTGG + Intronic
1046553502 8:115746800-115746822 TAATATAGCAGGAGGGAAGCAGG - Intronic
1048033569 8:130655577-130655599 AAGATTAGCAGCCGGCAAGCTGG + Intergenic
1050704954 9:8386347-8386369 TAGATTTGCAGCAGGGAAGAGGG - Intronic
1051480013 9:17549605-17549627 CAGTTTACAGGCAGGGAATCTGG - Intergenic
1052845008 9:33327802-33327824 TAGTTTAGCAGCATGGATGCAGG + Intronic
1053538568 9:38949858-38949880 AAAGCTAGCAGCAGGGAAGCAGG - Intergenic
1054627570 9:67414061-67414083 AAAGCTAGCAGCAGGGAAGCAGG + Intergenic
1054925094 9:70580799-70580821 CAGTTTAGCAGTAGGAAAAGGGG - Intronic
1056606419 9:88089479-88089501 CAGTTTAGAAATAGGAAAGCTGG - Intergenic
1058544605 9:106047273-106047295 AAGATTTTCAGCAGGGAAGCAGG + Intergenic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1059412564 9:114141972-114141994 CAGATGAGTAGCAGAGAAGCTGG - Intergenic
1060214565 9:121731017-121731039 CAGTTTGGGAGCAGGGAATCAGG - Intronic
1187312042 X:18154433-18154455 CATTTTGTCAGCAGGGCAGCAGG + Intergenic
1188473188 X:30562979-30563001 CATTTTAGAAGCTGAGAAGCAGG + Intronic
1189843329 X:45105816-45105838 GAGGTGAGCAGCAGGCAAGCTGG + Intronic
1190685853 X:52872494-52872516 CAGATTCCCAGAAGGGAAGCTGG - Intergenic
1191221396 X:57991342-57991364 TAGTGTAGCTTCAGGGAAGCAGG + Intergenic
1195468056 X:105202821-105202843 AAGTTTAGCTGCAAGGATGCAGG - Intronic
1196728009 X:118914554-118914576 CAGTTTAGAAGAAGGGATGGGGG - Intergenic
1197759022 X:130014945-130014967 TTGTTCAGCAGCAGGGATGCAGG - Exonic
1198453712 X:136794235-136794257 CAGGGTAGCAGCAGGGGAGGAGG - Intergenic
1199390819 X:147276346-147276368 CAGATTAGGACCTGGGAAGCAGG + Intergenic
1199817532 X:151411898-151411920 AAGCAAAGCAGCAGGGAAGCTGG + Intergenic
1199859618 X:151789620-151789642 AAAGTTAGCAGCAGGGATGCAGG + Intergenic
1199992092 X:152993138-152993160 GAGTTTGGCAGCAGGGGTGCAGG - Intronic
1202275843 Y:23118879-23118901 CAGTTTAGCCTCAGGGATGAAGG - Intergenic
1202290185 Y:23301812-23301834 CAGTTTAGCCTCAGGGATGAAGG + Intergenic
1202428837 Y:24752598-24752620 CAGTTTAGCCTCAGGGATGAAGG - Intergenic
1202441954 Y:24917491-24917513 CAGTTTAGCCTCAGGGATGAAGG + Intergenic