ID: 921398253 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:214692068-214692090 |
Sequence | CCTTCAGTATGGAAGATACA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
921398247_921398253 | -4 | Left | 921398247 | 1:214692049-214692071 | CCTAGCCAGTCTGTCCTTCCCTT | No data | ||
Right | 921398253 | 1:214692068-214692090 | CCTTCAGTATGGAAGATACATGG | No data | ||||
921398248_921398253 | -9 | Left | 921398248 | 1:214692054-214692076 | CCAGTCTGTCCTTCCCTTCAGTA | No data | ||
Right | 921398253 | 1:214692068-214692090 | CCTTCAGTATGGAAGATACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
921398253 | Original CRISPR | CCTTCAGTATGGAAGATACA TGG | Intergenic | ||
No off target data available for this crispr |