ID: 921398253

View in Genome Browser
Species Human (GRCh38)
Location 1:214692068-214692090
Sequence CCTTCAGTATGGAAGATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921398247_921398253 -4 Left 921398247 1:214692049-214692071 CCTAGCCAGTCTGTCCTTCCCTT No data
Right 921398253 1:214692068-214692090 CCTTCAGTATGGAAGATACATGG No data
921398248_921398253 -9 Left 921398248 1:214692054-214692076 CCAGTCTGTCCTTCCCTTCAGTA No data
Right 921398253 1:214692068-214692090 CCTTCAGTATGGAAGATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921398253 Original CRISPR CCTTCAGTATGGAAGATACA TGG Intergenic
No off target data available for this crispr