ID: 921404829

View in Genome Browser
Species Human (GRCh38)
Location 1:214767241-214767263
Sequence CAGGCTCAGCAGCCTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921404823_921404829 24 Left 921404823 1:214767194-214767216 CCCAGTTGTCCTTGTAGGCTGGT No data
Right 921404829 1:214767241-214767263 CAGGCTCAGCAGCCTGTTGGAGG No data
921404824_921404829 23 Left 921404824 1:214767195-214767217 CCAGTTGTCCTTGTAGGCTGGTT No data
Right 921404829 1:214767241-214767263 CAGGCTCAGCAGCCTGTTGGAGG No data
921404825_921404829 15 Left 921404825 1:214767203-214767225 CCTTGTAGGCTGGTTATAGCTTT No data
Right 921404829 1:214767241-214767263 CAGGCTCAGCAGCCTGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921404829 Original CRISPR CAGGCTCAGCAGCCTGTTGG AGG Intergenic
No off target data available for this crispr